ID: 934822824

View in Genome Browser
Species Human (GRCh38)
Location 2:97392765-97392787
Sequence TCCAACAATGAAGAAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934822824_934822829 11 Left 934822824 2:97392765-97392787 CCAATTTCTTCTTCATTGTTGGA No data
Right 934822829 2:97392799-97392821 TCCCTTTGGTTGGGCACCAGTGG No data
934822824_934822827 1 Left 934822824 2:97392765-97392787 CCAATTTCTTCTTCATTGTTGGA No data
Right 934822827 2:97392789-97392811 AAGGTTGCTTTCCCTTTGGTTGG No data
934822824_934822826 -3 Left 934822824 2:97392765-97392787 CCAATTTCTTCTTCATTGTTGGA No data
Right 934822826 2:97392785-97392807 GGAAAAGGTTGCTTTCCCTTTGG No data
934822824_934822828 2 Left 934822824 2:97392765-97392787 CCAATTTCTTCTTCATTGTTGGA No data
Right 934822828 2:97392790-97392812 AGGTTGCTTTCCCTTTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934822824 Original CRISPR TCCAACAATGAAGAAGAAAT TGG (reversed) Intergenic