ID: 934822829

View in Genome Browser
Species Human (GRCh38)
Location 2:97392799-97392821
Sequence TCCCTTTGGTTGGGCACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934822824_934822829 11 Left 934822824 2:97392765-97392787 CCAATTTCTTCTTCATTGTTGGA No data
Right 934822829 2:97392799-97392821 TCCCTTTGGTTGGGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934822829 Original CRISPR TCCCTTTGGTTGGGCACCAG TGG Intergenic