ID: 934827057

View in Genome Browser
Species Human (GRCh38)
Location 2:97434307-97434329
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934827053_934827057 18 Left 934827053 2:97434266-97434288 CCAGGCTGAGGCTTTGTGCAGGG No data
Right 934827057 2:97434307-97434329 TTCTCATTTCTGGTTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr