ID: 934827097

View in Genome Browser
Species Human (GRCh38)
Location 2:97434593-97434615
Sequence ACTTTGAGGCAGAAGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934827091_934827097 23 Left 934827091 2:97434547-97434569 CCCACTGCAGCTCTGGGGCAATC No data
Right 934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG No data
934827092_934827097 22 Left 934827092 2:97434548-97434570 CCACTGCAGCTCTGGGGCAATCT No data
Right 934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934827097 Original CRISPR ACTTTGAGGCAGAAGAGGAA GGG Intergenic
No off target data available for this crispr