ID: 934827180

View in Genome Browser
Species Human (GRCh38)
Location 2:97435095-97435117
Sequence AATCTGAGGCTACTAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934827180_934827181 -10 Left 934827180 2:97435095-97435117 CCAGTCTCTAGTAGCCTCAGATT No data
Right 934827181 2:97435108-97435130 GCCTCAGATTTTCCAGTACCTGG No data
934827180_934827185 28 Left 934827180 2:97435095-97435117 CCAGTCTCTAGTAGCCTCAGATT No data
Right 934827185 2:97435146-97435168 AGCCTGTGAAACAGCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934827180 Original CRISPR AATCTGAGGCTACTAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr