ID: 934829899

View in Genome Browser
Species Human (GRCh38)
Location 2:97508260-97508282
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 3, 1: 0, 2: 3, 3: 27, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934829899_934829902 4 Left 934829899 2:97508260-97508282 CCTTCAGTCTGCATATTGTTCAT 0: 3
1: 0
2: 3
3: 27
4: 195
Right 934829902 2:97508287-97508309 ACTTTTGTGCTGTAATTGCAGGG 0: 2
1: 1
2: 3
3: 13
4: 172
934829899_934829903 23 Left 934829899 2:97508260-97508282 CCTTCAGTCTGCATATTGTTCAT 0: 3
1: 0
2: 3
3: 27
4: 195
Right 934829903 2:97508306-97508328 AGGGCCGAGTTATTGCAACAAGG 0: 2
1: 2
2: 0
3: 2
4: 50
934829899_934829901 3 Left 934829899 2:97508260-97508282 CCTTCAGTCTGCATATTGTTCAT 0: 3
1: 0
2: 3
3: 27
4: 195
Right 934829901 2:97508286-97508308 TACTTTTGTGCTGTAATTGCAGG 0: 2
1: 1
2: 4
3: 18
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934829899 Original CRISPR ATGAACAATATGCAGACTGA AGG (reversed) Intronic
905607476 1:39315584-39315606 TTGAACTAGATGGAGACTGATGG - Exonic
906861730 1:49368041-49368063 CTGAAAAATATGCAAAGTGAGGG - Intronic
907008704 1:50942541-50942563 AAGATCAATATGCAAAATGAGGG + Intronic
909850358 1:80454591-80454613 ATGAACAGTATGCTTACTTAAGG - Intergenic
909940308 1:81603610-81603632 GTGAGCATTATGCAGAATGATGG - Intronic
910251922 1:85206843-85206865 ATCAACAAAATCCAGACTGTGGG + Intergenic
913356122 1:117923963-117923985 AGCAACAATATCCAGACTGTGGG - Intronic
914778352 1:150759585-150759607 AGGAATAATATGCACACTAATGG - Intronic
917909592 1:179629632-179629654 ATGCAAAATATGAAGACTGAAGG + Intronic
921532551 1:216302864-216302886 ATAGACAACATGTAGACTGAAGG - Intronic
924846330 1:247776027-247776049 AGGAATAAAATGCAGACTGGCGG + Intergenic
1062901250 10:1148470-1148492 ATGAACAGTATGCAAATGGATGG + Intergenic
1063079915 10:2757230-2757252 ACTAACAATATTCAGAGTGAAGG - Intergenic
1063163226 10:3435578-3435600 ATGAATAATTTACATACTGATGG - Intergenic
1064510521 10:16085019-16085041 ATTAACAATCTGCAAAATGATGG + Intergenic
1065567547 10:27029458-27029480 ATAAACAATATGCATATTGAAGG - Intronic
1065902533 10:30221609-30221631 CTGATGAATATGCAAACTGAGGG - Intergenic
1066252306 10:33646504-33646526 ATAAACAATATGGAAACTGCTGG + Intergenic
1068585984 10:58799193-58799215 ATCAACAGTATGCAGACCGAAGG + Exonic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072656999 10:97336493-97336515 ATCAAAGATATGCAAACTGAAGG - Intergenic
1073750264 10:106518076-106518098 ATGCACAATATGTAGACAAATGG - Intergenic
1074426021 10:113352177-113352199 ATGAAGAATATGCAGACAGCTGG - Intergenic
1078974143 11:16451692-16451714 ATGCACAATACCCAGAATGATGG - Intronic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079456640 11:20642260-20642282 ATGAACAATATCCAGACCAAGGG + Intronic
1080845311 11:36021617-36021639 TTGAAGAATATGCAGACTGTAGG + Intronic
1082279161 11:50252686-50252708 ATGAACAATATTCACTGTGACGG + Intergenic
1083983810 11:66196303-66196325 ATGAAAAAGATGCAGACTCAAGG - Intronic
1086402213 11:86470058-86470080 GTGAACCAAATGCAGAGTGAGGG + Intronic
1091375352 12:21620-21642 ATGAACAATGTCCACCCTGAGGG + Intergenic
1091677639 12:2502907-2502929 ATGGTTAATATGCAGACTGTGGG + Intronic
1094561551 12:31558637-31558659 ATGAAAAATACTCATACTGATGG + Intronic
1095146663 12:38738107-38738129 ATGAACAGTATGTAGACTGGTGG - Intronic
1095354806 12:41259354-41259376 AAGAAAAAGATGCAGAGTGAGGG + Intronic
1095748742 12:45688124-45688146 ATGAATAAAATGGAAACTGATGG + Intergenic
1095991824 12:48040074-48040096 ATGAACAGTATTCAGACTCCTGG + Intergenic
1098025977 12:66201875-66201897 ATGAATAATAACCACACTGAAGG + Intronic
1099153041 12:79139368-79139390 ATGAAGCTGATGCAGACTGAGGG - Intronic
1099529757 12:83763413-83763435 AGGGACAATGTGCAGACTTAAGG - Intergenic
1099727181 12:86447018-86447040 ATGAACAATACGAAGGCTAAGGG + Intronic
1100196406 12:92250959-92250981 ATGAAGAATGTGAAGAATGATGG + Intergenic
1100471690 12:94899499-94899521 ATGAACAAAATCCAGACTGTAGG + Intronic
1104738193 12:131152932-131152954 ATGAACAATACTCAGGCAGAAGG + Intergenic
1105200838 13:18174707-18174729 ACGAACAATATGCAGATTGAAGG - Intergenic
1105349798 13:19604743-19604765 ATGCACATTTTGCACACTGAGGG - Intergenic
1107094215 13:36517195-36517217 ATGAGAAATATGTAGACTGGAGG - Intergenic
1107565042 13:41593684-41593706 TTGTACAATGTGAAGACTGAAGG - Intronic
1109114703 13:58366999-58367021 CTGAACAAAATGGATACTGAAGG - Intergenic
1109896350 13:68696412-68696434 ATTATAAATATGCAGACTCATGG + Intergenic
1109988246 13:70017646-70017668 ATGAGCAATACTCAGACCGAAGG + Intronic
1110107749 13:71699755-71699777 AAGACCAATATGCACACTCAAGG - Intronic
1110325379 13:74208029-74208051 ATGAAGAATTTACAGAATGAAGG + Intergenic
1110973186 13:81793636-81793658 ATGAAAAATATGCACACCCAGGG + Intergenic
1116724128 14:48540036-48540058 ATGAACAAAATGCATTCAGATGG - Intergenic
1116858776 14:49977285-49977307 AGGAACAATATGCACACATAGGG + Intergenic
1117100389 14:52340054-52340076 AAGAAAAATAAACAGACTGAGGG - Intergenic
1117787300 14:59299753-59299775 GTGAACAAAATGCAGTCTGTTGG + Intronic
1118911445 14:70065260-70065282 ATCAACAATATGGACACTGCAGG - Intronic
1119152762 14:72378364-72378386 ATGAACAATATTGAAACTGAAGG + Intronic
1120496322 14:85241486-85241508 TTCAACATTGTGCAGACTGAGGG - Intergenic
1121198806 14:92099521-92099543 CTGAATAATATGCAAATTGAAGG + Intronic
1121653987 14:95581589-95581611 GTGAACAAGCTCCAGACTGAGGG - Intergenic
1125445171 15:39746510-39746532 ATGGACAATGAGCAGACTCAAGG + Intronic
1134115545 16:11545209-11545231 ATAGACAGAATGCAGACTGACGG + Intergenic
1134806258 16:17128048-17128070 ATGAAAAACATGCTGACTGTAGG + Intronic
1139093545 16:63677684-63677706 AGAAACATTATGCAGAGTGAAGG + Intergenic
1139610950 16:68058147-68058169 ATGAAGAAGAAGCAGACTGCAGG + Intronic
1141009284 16:80382289-80382311 ATGAAAAATATGCAAAGTGAAGG + Intergenic
1141364447 16:83429403-83429425 ATGAATAAAATCCAGACTGAAGG - Intronic
1143385146 17:6524782-6524804 ATGAACAATAGCCAAACAGATGG + Intronic
1143677361 17:8444532-8444554 TTGAACAATATAAAGACTTATGG - Intronic
1143967412 17:10766573-10766595 ATGAGGAATATGCAGACTCTTGG + Intergenic
1144531833 17:16046627-16046649 ATGGACAAAATGAAGACTGATGG + Intronic
1145326387 17:21832308-21832330 AGGAAAAATATATAGACTGATGG + Intergenic
1146657648 17:34644484-34644506 ATGAAGAATACCCAGTCTGATGG + Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147541335 17:41362600-41362622 GGGAATAATCTGCAGACTGAGGG + Intergenic
1147784639 17:42970387-42970409 AAGAACAATCTGCACATTGATGG + Intronic
1149533286 17:57412751-57412773 ATGAAAACTATACAGTCTGAGGG - Intronic
1152986265 18:324200-324222 ATTATAAACATGCAGACTGAGGG - Intronic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1155426817 18:25715750-25715772 ATGAACAAGGAGCAGACTCAAGG - Intergenic
1155901931 18:31402048-31402070 ATGACCAATATGCAAACATAGGG - Intronic
1156818157 18:41337341-41337363 CTGAACAATATGTACTCTGATGG + Intergenic
1157238716 18:45989080-45989102 TTGAACAATATGAAGATTTAAGG - Intronic
1159176351 18:64840076-64840098 ATGTCCACTTTGCAGACTGAAGG - Intergenic
1159499061 18:69245335-69245357 ATGAAGAAGAGGCAGATTGAAGG + Intergenic
1160469379 18:79114790-79114812 ATGCACACTATGCACACTAATGG - Intronic
1167918519 19:52761982-52762004 AGTAACATGATGCAGACTGATGG + Intergenic
926264240 2:11300163-11300185 AGGAGCAATATGCAGATTTATGG - Intronic
926439126 2:12869523-12869545 ATGATCAATATGTGGGCTGAAGG - Intergenic
927808272 2:26167385-26167407 ATTAACAAAATGCAGACTGTAGG + Intergenic
928387978 2:30885649-30885671 GTGAGCAAAAGGCAGACTGAGGG + Intergenic
931036320 2:58247123-58247145 ATGACGAATTTTCAGACTGAAGG + Intergenic
931412547 2:62047111-62047133 ACTAGCAATATGCAGACTTAAGG - Intronic
934116648 2:88804163-88804185 ATTAACGATATGCAGATTGAAGG + Intergenic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935474253 2:103498922-103498944 AAGAACATTATGTTGACTGAAGG + Intergenic
937438663 2:121899194-121899216 AGAAAAAACATGCAGACTGAAGG - Intergenic
938418805 2:131126659-131126681 ATGAAAAATAAGCAGAATAAAGG - Intronic
938471615 2:131568076-131568098 ATGAACCATATGGAGACAGCAGG + Intergenic
939994623 2:148908261-148908283 ATAAAGAATGTGCAGACTGTGGG - Intronic
941011817 2:160308639-160308661 ATTCACAATATGCAGAATGTTGG + Intronic
942658389 2:178238723-178238745 ATGAACAATGTTCCTACTGATGG + Intronic
943766997 2:191673880-191673902 ATGAACTAATTGAAGACTGATGG - Intergenic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
1173027475 20:39322064-39322086 ATCATCAAAATGCAGACTGTAGG - Intergenic
1174862246 20:54102073-54102095 ATGATCAAAGTGCAGAGTGAAGG + Intergenic
1177121276 21:17139843-17139865 AGGAACAATATCGAGAATGAAGG - Intergenic
1178982499 21:37276694-37276716 CTGAACAATATGGAGAAAGAAGG + Intergenic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
1182053790 22:27333778-27333800 AAGAACAATGTGGAGACAGAAGG + Intergenic
1182773256 22:32811209-32811231 ATCAAAGATAAGCAGACTGAGGG + Intronic
1184687152 22:46101794-46101816 ATGGACAAAATGCAGAGTGATGG + Intronic
1185305232 22:50111866-50111888 ATCAAAAATAAGCAGACTGATGG - Intronic
951296548 3:20943329-20943351 ATAAAACAGATGCAGACTGAAGG + Intergenic
951865870 3:27306592-27306614 ATGAACATTATGGGGACTCATGG - Intronic
952508804 3:34033953-34033975 AAGAACTATATGCAGACAGCAGG - Intergenic
955989505 3:64611439-64611461 ATAAACACAATGCAGACTGGTGG + Intronic
956370893 3:68559609-68559631 ATCAACAAAATGCAGACTTTGGG + Intergenic
956370918 3:68560128-68560150 ATCAACAAAATGCAGACTTTGGG - Intergenic
957450361 3:80373532-80373554 GTTAACAATATGAAGAATGAAGG - Intergenic
957839577 3:85650924-85650946 ATGCACAAAATGCATGCTGATGG + Intronic
958079189 3:88723633-88723655 ATGAACAATCTTGAGAGTGAAGG + Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
959729377 3:109583618-109583640 TTGAACAATATGAAATCTGATGG + Intergenic
959877828 3:111406747-111406769 ATGATCAATATCAAGAATGAGGG - Intronic
960290296 3:115876312-115876334 ATGATCCCTATGCAAACTGAGGG - Intronic
961026494 3:123562778-123562800 ATCAACAATATGTAAACTAAAGG + Intronic
961501162 3:127337099-127337121 ATTATCAAGATTCAGACTGAGGG + Intergenic
963200705 3:142583178-142583200 ATGAACAAAAAGCATGCTGAGGG + Intergenic
966685589 3:182691212-182691234 ATTAACAATATGGAAACAGATGG + Intergenic
967966622 3:194965445-194965467 ATGAACTAAAGGCACACTGATGG - Intergenic
971204221 4:24547648-24547670 ATGAAAACTAGGCAGGCTGAGGG + Intronic
974602054 4:64095902-64095924 ATGGACAATGTCCAGCCTGAAGG - Intergenic
974755152 4:66195958-66195980 AAGACCTATATGCTGACTGAAGG - Intergenic
976113208 4:81699033-81699055 AGGAAGAATATGCAGGGTGAAGG - Intronic
976998865 4:91469700-91469722 TTAAACAATATGCAGAATTATGG - Intronic
977000491 4:91492730-91492752 ATGAATAATTTTCTGACTGAGGG + Intronic
977248919 4:94666726-94666748 ATGAATAATATGTAGAAAGAAGG - Exonic
978068158 4:104431904-104431926 ATGAAATATATGCAGAATCAGGG + Intergenic
978811279 4:112852269-112852291 ATGAAGAATATGAAGAGTCAAGG - Intronic
980188685 4:129495292-129495314 ATTCACAATATGCAGACTTGAGG - Intergenic
980950810 4:139374340-139374362 AAGAATAATATGCATAATGATGG + Intronic
984331293 4:178322788-178322810 TTGAACAAAAAGCAGACTCATGG + Intergenic
986105849 5:4658656-4658678 CTGAACTTTATGCACACTGAGGG + Intergenic
987170391 5:15250832-15250854 ATGATCAAAATGCAGGGTGAAGG - Intergenic
988937032 5:36094598-36094620 ATGAAGTATATGCTGACTGAAGG - Intergenic
990798955 5:59577563-59577585 AAGAAAAATATGGAGACTCAAGG + Intronic
992794956 5:80247607-80247629 TTGAACAGTATGGAGAGTGAAGG - Intronic
993605310 5:89983391-89983413 ATTAAAAACATGCAGACTCAAGG - Intergenic
994537438 5:101049381-101049403 AGGAACTAGATGAAGACTGAAGG + Intergenic
996513489 5:124344034-124344056 ATCAACAGAATGCAGACTGTCGG - Intergenic
997428337 5:133819782-133819804 ATAAAGAATATTCAGGCTGAGGG + Intergenic
998181134 5:139943899-139943921 ATAAACAATATGCAAACAAATGG + Intronic
1001176505 5:169473952-169473974 AAGTAGAACATGCAGACTGATGG + Intergenic
1004952915 6:20694487-20694509 ATGGACAATATGCAAGCTGTGGG - Intronic
1005879205 6:30042119-30042141 ATGAACAAGATGGGGGCTGAGGG - Intergenic
1008878483 6:56355340-56355362 ATCAACAAGATTCAGACTGTGGG + Intronic
1009381663 6:63039107-63039129 AATAACAATATGCTGAGTGAAGG + Intergenic
1010847036 6:80721119-80721141 ATGAACAATACTCAGGCAGAAGG + Intergenic
1010938777 6:81891294-81891316 CTGAACAAAATGCACACTGAGGG - Intergenic
1011350267 6:86415297-86415319 ATAAACCATATACAGACTGCTGG - Intergenic
1012752477 6:103181747-103181769 ATGCACAATAGGCTGACGGACGG + Intergenic
1012973238 6:105753719-105753741 ATTAGCATTATGCAGACTGTGGG + Intergenic
1013334157 6:109138092-109138114 CTGAACAAAAGGGAGACTGAAGG + Intronic
1013558832 6:111284058-111284080 TTGGAAAATTTGCAGACTGATGG - Intergenic
1014777743 6:125529814-125529836 ATGAAGAAGATGAAGTCTGAAGG - Intergenic
1015884883 6:137906828-137906850 AGGAATAAAATGCAGATTGAAGG + Intergenic
1015979939 6:138828387-138828409 ATCAGCAAAATGCAGACTGTGGG - Intronic
1016590376 6:145736845-145736867 ATGAAAAATGTGAAGACAGAAGG + Intergenic
1018086369 6:160304342-160304364 TTGAAAAATTTGCAGTCTGACGG - Intergenic
1018134649 6:160767455-160767477 ATGAACCATCTGCTGGCTGAAGG + Intergenic
1018182149 6:161233468-161233490 ATGAACAATCTGTATACAGATGG + Intronic
1018813384 6:167313922-167313944 GTGGACAATGTGCAGACTGTGGG + Intronic
1019161762 6:170073665-170073687 ATTCACAATATGCAGAGTAAAGG - Intergenic
1020587615 7:10089079-10089101 ATGACCAATGTGCAAAGTGAGGG + Intergenic
1021107987 7:16660920-16660942 ATGGACAATATGCAGACAAATGG - Intronic
1021481703 7:21125018-21125040 TTGAACAACATGCAGACACACGG - Intergenic
1022750916 7:33224670-33224692 ATGAGCAAAATCCAGACTGTGGG - Intronic
1023007820 7:35892391-35892413 ATGAACAATATTCACTATGATGG - Intronic
1023015100 7:35959857-35959879 ATGAACAATATTCACTATGATGG - Intergenic
1023266112 7:38407916-38407938 ATGCACATTCTGTAGACTGAGGG + Intronic
1023529123 7:41135558-41135580 ATGAGCAATATTCAGGCAGAAGG - Intergenic
1023693897 7:42824813-42824835 ATAAACAAAATGCATACTAAAGG + Intergenic
1024065847 7:45734837-45734859 ATGAACAATATTCACTATGATGG + Intergenic
1024786416 7:52912107-52912129 ATGAACAATATTCAGGCAGAAGG + Intergenic
1025217041 7:57066327-57066349 ATGAACAATATTCACTATGATGG + Intergenic
1025627966 7:63239969-63239991 ATGAACAATATTCACTATGATGG + Intergenic
1027492131 7:78841454-78841476 AGAAACAGTGTGCAGACTGAGGG - Intronic
1027704728 7:81514797-81514819 TTGAAAAATATGCAGTCTGACGG - Intergenic
1028912539 7:96224540-96224562 ATGAACAGAATTCTGACTGAAGG - Intronic
1031440844 7:121792819-121792841 ATGAAGTATTTTCAGACTGAGGG + Intergenic
1032573740 7:133029701-133029723 GTGAAGAAAATGCAGACTGGAGG + Intronic
1036617813 8:10402473-10402495 ATGCACAAAATGCAGCCTCAGGG - Intronic
1039926789 8:41941172-41941194 AGGAACAATATGGAGAATGTGGG - Exonic
1041029419 8:53720870-53720892 ATGAAAAATTTGCACACTAAAGG - Intronic
1043116700 8:76264175-76264197 AGTAACAAGATGGAGACTGAGGG - Intergenic
1043695396 8:83209790-83209812 ATGAGCAATACTCAGACAGAAGG + Intergenic
1046186880 8:110733920-110733942 GTGAGCAATATTCAGACAGAAGG - Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1049384167 8:142332720-142332742 ATGCCCAAGATGCTGACTGAGGG - Intronic
1050458372 9:5855816-5855838 AAGAAAAATATGTAGACTTAGGG + Intergenic
1050771708 9:9209262-9209284 ATGAACAAAATTCAGACTGTGGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1055409658 9:76015569-76015591 ATGACCAATATGAAGAGTGGTGG + Intronic
1057541290 9:95973908-95973930 ATTAGCAAAATGCAAACTGAGGG - Intronic
1059551116 9:115230353-115230375 AATAACAATATTCAGAATGATGG + Intronic
1059861900 9:118473765-118473787 ATGAACAAAAGCCAGACTGTGGG + Intergenic
1203583518 Un_KI270746v1:39238-39260 ACAAACAATATGCAGATTGAAGG + Intergenic
1186269462 X:7869480-7869502 ATACACAAAATGCATACTGAGGG - Intergenic
1186302029 X:8210723-8210745 ATAAGTAATATGCAGACTGTGGG + Intergenic
1187474157 X:19595422-19595444 CTCAACAAAATGCAGGCTGAGGG + Intronic
1188776643 X:34228092-34228114 ATTCACATTAAGCAGACTGATGG - Intergenic
1189457493 X:41206518-41206540 ATCAACAAAATTCAGACTGTGGG - Intronic
1192216117 X:69159642-69159664 ATGAACAACATCCAGCCTGTTGG + Intergenic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1195203136 X:102568411-102568433 ATTCACAATATACAGACTGAAGG - Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197313867 X:124939758-124939780 ATGAATATTATTCAGACAGAGGG - Intronic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1198704151 X:139429147-139429169 ATCAGCAACATGCAGACTGTGGG - Intergenic
1201351900 Y:13053151-13053173 AAGAAAAAGATGCAGATTGATGG - Intergenic