ID: 934830924

View in Genome Browser
Species Human (GRCh38)
Location 2:97523840-97523862
Sequence ATTCAAATGGATCAAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 4, 1: 1, 2: 0, 3: 38, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934830921_934830924 12 Left 934830921 2:97523805-97523827 CCCATTTTACACAAGAGATTTTC 0: 4
1: 0
2: 3
3: 29
4: 337
Right 934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG 0: 4
1: 1
2: 0
3: 38
4: 333
934830922_934830924 11 Left 934830922 2:97523806-97523828 CCATTTTACACAAGAGATTTTCA 0: 4
1: 0
2: 6
3: 37
4: 400
Right 934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG 0: 4
1: 1
2: 0
3: 38
4: 333
934830920_934830924 13 Left 934830920 2:97523804-97523826 CCCCATTTTACACAAGAGATTTT 0: 4
1: 0
2: 3
3: 49
4: 534
Right 934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG 0: 4
1: 1
2: 0
3: 38
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934830924 Original CRISPR ATTCAAATGGATCAAATAAT TGG Intronic
900860161 1:5223217-5223239 ATGGAAATGCATCAACTAATGGG + Intergenic
901657348 1:10777035-10777057 TTCCAAATGGCTCAAATACTGGG + Intronic
904579716 1:31533365-31533387 AATCAAATTGTTCAAATGATAGG - Intergenic
907847443 1:58222016-58222038 ATTCTAATGGATTAAATACTTGG - Intronic
908541483 1:65126821-65126843 ATTAAAATGGATTTAATAGTAGG + Intergenic
909147131 1:71949565-71949587 ATTCTACTGGAACAAAGAATAGG + Intronic
910009639 1:82445199-82445221 ATTGAAAAGGATTAAGTAATTGG + Intergenic
910461810 1:87455402-87455424 ATGCAAATGTATAAAACAATGGG - Intergenic
910976639 1:92913499-92913521 ATACAAAAGGAGCCAATAATAGG - Intronic
911107640 1:94148836-94148858 ATTCAAATAGATCATTTTATGGG + Intergenic
911424045 1:97684446-97684468 TCTCAAATCGATCACATAATTGG - Intronic
912037152 1:105332316-105332338 ATTCCAATTGATCATATGATAGG - Intergenic
913104927 1:115605113-115605135 ATGCAAAAGGATGAAAAAATGGG + Intergenic
913401296 1:118437156-118437178 ATTCCAATGAAACAAATATTAGG + Intergenic
915223988 1:154398227-154398249 ATGCAAATGGAACACATGATTGG + Intergenic
915521371 1:156446610-156446632 ATTCAAATTAATCAAACATTTGG - Intergenic
915770541 1:158417856-158417878 ATTCACATGGAAAAAATAAGAGG + Intergenic
915995668 1:160560218-160560240 TTTAAAATTGATCACATAATAGG + Intronic
917378215 1:174373944-174373966 ATTCAATTGGACCAGATAAATGG - Intronic
917855623 1:179096989-179097011 ATTCAAATCAATGAAATAAAAGG + Intronic
918389390 1:184042287-184042309 ATTCATATGGAACAAAAAAGAGG + Intergenic
918614538 1:186529569-186529591 TCTAAAATGGATCACATAATCGG - Intergenic
918827433 1:189342927-189342949 ATTCAAAAGTTTCAAATATTAGG - Intergenic
919549670 1:198968934-198968956 TTACAAATAGCTCAAATAATTGG - Intergenic
920681798 1:208078753-208078775 ATTAAAATGCATGAAAAAATTGG + Intronic
921707568 1:218341816-218341838 ATACAAATGGAAATAATAATCGG + Intergenic
922901520 1:229140727-229140749 ATTTTAATGGATGACATAATAGG + Intergenic
923401212 1:233616701-233616723 TATCAAATGTGTCAAATAATGGG - Intronic
923401215 1:233616751-233616773 CATCAAATGAATCAAATAATGGG - Intronic
924851773 1:247838337-247838359 ATTCATCTGGTTCAAATATTGGG - Intergenic
1063113364 10:3055270-3055292 TTTTAAATGGATCAAATATTAGG + Intergenic
1064241471 10:13633495-13633517 ATTCAAATCTATCAAAGATTTGG - Intronic
1065565126 10:27000643-27000665 AATCAAAAGTATCAAATAACTGG + Intronic
1065991442 10:31013784-31013806 TTTTAAATGAATCAAATGATGGG - Intronic
1066195376 10:33094012-33094034 CTTCAAATGTATGAAATGATTGG - Intergenic
1068997423 10:63223641-63223663 ATTCAACAGGTTAAAATAATGGG + Intronic
1071999696 10:91183032-91183054 CTTAAAATTGATCATATAATCGG - Intronic
1072161165 10:92768000-92768022 ATTCAAAGGAAACAAATAAATGG + Intergenic
1072400070 10:95088825-95088847 ATTCATATGGAACAAAAAAAGGG + Intergenic
1073361994 10:102907217-102907239 ATTCAAATGGTTTAAATGATGGG + Intergenic
1073921883 10:108468446-108468468 ATCCAAATGGATCAACTGAAAGG - Intergenic
1073953626 10:108841009-108841031 ATTCAACAGAATCACATAATTGG + Intergenic
1074308079 10:112297459-112297481 ATACAAAGGGATAAAATTATGGG - Intronic
1074555106 10:114481774-114481796 ACTCAAAAGGATGAAATACTTGG + Intronic
1074873395 10:117595474-117595496 TCTCAAATGGTTCAAATAAAGGG + Intergenic
1075281835 10:121145461-121145483 TCTAAAATGGATCACATAATTGG - Intergenic
1076257522 10:129040034-129040056 ATTGAAATGCAACCAATAATGGG - Intergenic
1077475180 11:2784676-2784698 ATTAAAGTAGATCAAATAAATGG - Intronic
1077866554 11:6226328-6226350 ATCCATATGGATAAAATACTGGG + Intronic
1078461805 11:11520237-11520259 TTTAAAATGGAGAAAATAATTGG - Intronic
1078517388 11:12034573-12034595 ATGCCAATGAATCAAATATTTGG - Intergenic
1078659336 11:13274355-13274377 ATTCTAATGGATCCAATCATTGG + Intergenic
1078970815 11:16409131-16409153 ATTCCAATGGATTAAACCATAGG + Intronic
1079519345 11:21307287-21307309 CTGCAAATGGATTAAATTATTGG - Intronic
1079700012 11:23534354-23534376 ATTCAGATGGCTGAAATAAATGG - Intergenic
1079745710 11:24126365-24126387 ATTCAAATGAAAATAATAATGGG - Intergenic
1080347217 11:31338377-31338399 ATTCAAATGGATCATATTTGGGG + Intronic
1081305197 11:41503239-41503261 ATTCACATGAAGCAAATAGTAGG - Intergenic
1084205790 11:67591772-67591794 AATCAAATAGATCATGTAATGGG + Intergenic
1084929049 11:72539231-72539253 ATTTAAATTGATAAACTAATGGG - Intergenic
1087542366 11:99536073-99536095 ATACAAATGAATCATTTAATAGG + Intronic
1087546966 11:99597154-99597176 ACTCAAATGAATCATATGATTGG - Intronic
1087948385 11:104193578-104193600 CTTCAAATGGATTTAATCATAGG - Intergenic
1088945364 11:114506457-114506479 TTTTAAATCGATCACATAATTGG + Intergenic
1089897748 11:121948888-121948910 ATTCAGAAGGATGAAAGAATTGG - Intergenic
1089969371 11:122680129-122680151 TTTTAAATGGTTAAAATAATTGG - Intronic
1090515511 11:127422483-127422505 ATTCAAAGGGATAATATAAAAGG - Intergenic
1092554703 12:9544959-9544981 AGACAAATAAATCAAATAATAGG - Intergenic
1093751460 12:22804830-22804852 ACTCAAGAGGATCAAAGAATTGG + Intergenic
1094517398 12:31145670-31145692 AGACAAATAAATCAAATAATAGG + Intergenic
1095642819 12:44504322-44504344 ATTCAATTTAATGAAATAATGGG - Intergenic
1095747790 12:45678599-45678621 AATTAATTGAATCAAATAATAGG + Intergenic
1095891376 12:47237307-47237329 ATTAAAATTGTTCAAATAATAGG + Intergenic
1096279810 12:50243060-50243082 ATTCAAATGGATGTATCAATAGG + Intronic
1096702742 12:53396712-53396734 AGACAAATGTATGAAATAATAGG + Intronic
1097470365 12:59983309-59983331 TTTAAAATTGATCACATAATCGG + Intergenic
1097895769 12:64824009-64824031 ATTAAAATGGATGAAAGAAAGGG - Intronic
1098746882 12:74249016-74249038 ATTCAACTAGATAAAATAAGAGG - Intergenic
1099002619 12:77197648-77197670 CTTAAAATGGATCTAATAATAGG + Intergenic
1099141736 12:78985801-78985823 ATTTAAATAGATTAAATAAAGGG - Intronic
1100795275 12:98175688-98175710 ATTAAATTGGATCAAACAAAAGG + Intergenic
1104516996 12:129436902-129436924 TTTTAAATGTATCAAATTATAGG - Intronic
1105666768 13:22567884-22567906 ATACACATGGATTAAATTATAGG - Intergenic
1105721696 13:23123062-23123084 ATTCGAATGGAAAAAATATTAGG + Intergenic
1106878517 13:34103629-34103651 TTTTAATTGGATCAAATAATTGG - Intergenic
1107000175 13:35534894-35534916 ATTCAAATGAAACAAATAAAAGG + Intronic
1107009264 13:35651855-35651877 ATTGAAATGGATCCATTAATAGG + Exonic
1107457925 13:40571960-40571982 TTTAAAATGGATCAAAGTATTGG - Intronic
1108866321 13:54927180-54927202 AATCAAATGGATAGAAAAATAGG - Intergenic
1109168254 13:59062675-59062697 ATTAAATTGGTTCAAATCATAGG + Intergenic
1109448814 13:62481964-62481986 ATTCAAATAGAAAAAAAAATAGG - Intergenic
1109689756 13:65870208-65870230 ATTCTAATGGATAAAATAGATGG - Intergenic
1109705690 13:66089040-66089062 ATGCAAATGGATCCAATACTTGG + Intergenic
1111253853 13:85640070-85640092 ATTAAAATGTATCAAGTTATAGG - Intergenic
1111700704 13:91684308-91684330 ATACAATTAGATAAAATAATTGG - Intronic
1113143012 13:107175499-107175521 ATCCAAAAGAATCAAAGAATAGG - Intronic
1113540689 13:111106194-111106216 ATTCATATGGATCAAAAAAATGG + Intergenic
1115181971 14:30638446-30638468 TTTCAAATTCATTAAATAATAGG - Intronic
1116317878 14:43420240-43420262 ATTCAAATGGAATAAATGATTGG - Intergenic
1116334890 14:43644873-43644895 TTTCAAATGGAAAAAAAAATAGG + Intergenic
1116383828 14:44306152-44306174 AACCAAATGGATTAAATAATGGG - Intergenic
1117138046 14:52757491-52757513 ATCCAAATGAAACAAGTAATTGG - Intronic
1117433616 14:55695933-55695955 ATTCAAACGCTTCAAATAAAAGG - Intronic
1118040759 14:61913999-61914021 ATTCAAATGGAAGAAATTACTGG + Intergenic
1118229472 14:63934409-63934431 GTTCAAATGGAGCACATAATCGG - Intronic
1125867496 15:43066446-43066468 ATTCAAATGGAACCAAAAAAGGG - Intronic
1126479397 15:49101100-49101122 ATTCAAAAGAAACAAATAAAAGG + Intergenic
1127162094 15:56199574-56199596 ATTCAAATATGTCAAATAACAGG + Intronic
1127689138 15:61377428-61377450 ATTCAAATGGATAATGAAATGGG + Intergenic
1128995873 15:72294088-72294110 ATTCGAATGCAGCAAATGATGGG + Intronic
1129041476 15:72690136-72690158 ATCCAAATACATCAAATAATGGG - Intronic
1130239302 15:82170894-82170916 ATTCAAATGACTTAAATAAATGG + Intronic
1130440473 15:83947734-83947756 ATGGAAAAGGATCAAATATTGGG - Intronic
1131769668 15:95722503-95722525 ATTAAAATAGACCAAATGATGGG - Intergenic
1133455823 16:5941623-5941645 ATTAAAATGTGCCAAATAATTGG + Intergenic
1137065220 16:35833821-35833843 TTTAAAATTGATCACATAATCGG - Intergenic
1138120458 16:54397062-54397084 TTTAAAATGGATAAAATAATAGG + Intergenic
1139659903 16:68413650-68413672 ATTGAAATGGATCCAAAAAATGG + Intronic
1140636130 16:76916107-76916129 AGTCAGATGGGCCAAATAATTGG - Intergenic
1141074670 16:80993074-80993096 ATACATATGAATCAACTAATGGG - Intronic
1141788619 16:86218009-86218031 AATCAAAAGGAGCAAATACTGGG + Intergenic
1144044266 17:11440790-11440812 ATTCAAATGGAGTTAATAATAGG + Intronic
1144363099 17:14515356-14515378 ATGCAAATGTTTCTAATAATGGG + Intergenic
1146088065 17:29848736-29848758 GGTCAAATAGATAAAATAATAGG + Intronic
1147051386 17:37797223-37797245 ATCCCAATGGAGCATATAATGGG - Intergenic
1149808637 17:59644064-59644086 ATTCAACTGTTTCAAATAAGAGG - Intronic
1150374618 17:64670394-64670416 TTTTAAAAGGATAAAATAATTGG - Intergenic
1152994547 18:394328-394350 TAGAAAATGGATCAAATAATTGG - Intronic
1153349728 18:4065825-4065847 ATTCACATGGAACAAAAAAAGGG + Intronic
1153510978 18:5852073-5852095 ATTCAAATATAACAAATATTAGG + Intergenic
1153556526 18:6320749-6320771 ATTCATATGGAACCAAAAATGGG + Intronic
1154178338 18:12105621-12105643 ATTAGAATGCACCAAATAATTGG - Intronic
1155803414 18:30137024-30137046 AATCAAACAGATCAAAAAATGGG + Intergenic
1155816164 18:30313655-30313677 AATTAAATGTATCAAATATTTGG - Intergenic
1156014062 18:32527762-32527784 ATTAAATTGGATGATATAATGGG - Intergenic
1156362597 18:36397552-36397574 ATTAAAATATAACAAATAATGGG - Intronic
1156800229 18:41102148-41102170 GATCAAATGCATGAAATAATTGG - Intergenic
1157657061 18:49400700-49400722 ATTCTAATGTAACAAATAATTGG - Intronic
1159148374 18:64484708-64484730 ATTTAAATGTGTCAAATACTGGG + Intergenic
1159646834 18:70928799-70928821 ATATAAATGGATCAAATATATGG + Intergenic
1159888366 18:73932070-73932092 ATTCAAATGTAAGAAATGATAGG - Intergenic
1160262911 18:77312126-77312148 AATCAAATAGATCAAAGAACGGG + Intergenic
1162367018 19:10255844-10255866 ATTAAAATTGTTCAAAAAATAGG + Intronic
1163995750 19:21045484-21045506 TTTAAAATTGATCACATAATTGG - Intronic
1165575686 19:36815114-36815136 AATCAAAATGATGAAATAATAGG - Intergenic
925619590 2:5778396-5778418 GTTGAAATGAAACAAATAATGGG - Intergenic
926389925 2:12379146-12379168 ATTCAACTGGACAAAAAAATGGG + Intergenic
927800436 2:26094213-26094235 AATGAAATGGATGAAATAAGGGG - Intronic
929105969 2:38366317-38366339 AGCCAAATAGAGCAAATAATTGG - Intronic
930217597 2:48712774-48712796 CATAAAATGGATCCAATAATAGG - Intronic
930269990 2:49244877-49244899 ACTAAAATTGACCAAATAATTGG + Intergenic
930383316 2:50659348-50659370 AATAAAATGGATCAAGTAATAGG - Intronic
930437662 2:51365548-51365570 AGACAAATGCTTCAAATAATTGG + Intergenic
930455483 2:51603371-51603393 ACTAAAATTGATCACATAATTGG - Intergenic
932427676 2:71651230-71651252 ATTGAAAAAAATCAAATAATTGG + Intronic
933889052 2:86749058-86749080 ATTCAAATGCATAAAGGAATGGG - Intronic
934116182 2:88796888-88796910 ATTCAAATGGATCAAATAATGGG - Intergenic
934626974 2:95867954-95867976 ATTCAAATGGATCAAATAATTGG + Intronic
934806585 2:97233335-97233357 ATTCAAATGGATCAAATAATTGG - Intronic
934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG + Intronic
935449552 2:103193040-103193062 TTTAAAATTGATCACATAATTGG + Intergenic
936842593 2:116790904-116790926 ATTCAAATGGATGAAAAAACAGG - Intergenic
937499744 2:122465286-122465308 ATTCAAATGGATAGTAGAATCGG + Intergenic
939365207 2:141221652-141221674 TCTAAAATGGATCATATAATTGG + Intronic
939975932 2:148717659-148717681 AGTAAAATTGATCACATAATTGG - Intronic
940624306 2:156153079-156153101 TGTCAAACGGATCAAATAAGTGG + Intergenic
941576890 2:167243874-167243896 ATTGAAAAGGAAAAAATAATAGG + Exonic
942901264 2:181121892-181121914 ATTCAAAATGCTCAAATAAAAGG - Intergenic
944292316 2:198020973-198020995 TTTAAAATGGACCACATAATTGG + Intronic
944514848 2:200502573-200502595 ATTCAAATGAATGAATGAATAGG - Intronic
945098734 2:206243908-206243930 TTTCAAATGGTTTACATAATTGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945785004 2:214222924-214222946 ATTCATTTGGTTCAAATAAATGG - Intronic
946267002 2:218553873-218553895 ATTTAAATGTATCAAGAAATGGG - Intronic
946998159 2:225420011-225420033 ATTCAAAAGGATGCAATAATTGG + Intronic
1172747397 20:37222694-37222716 ATTCAAACCTATCAAATATTTGG + Intronic
1175329301 20:58151744-58151766 ATTCAAATTTAACAAATATTAGG - Intronic
1175405634 20:58724306-58724328 ATTGAAATGGATGGAAAAATAGG + Intergenic
1175559718 20:59911158-59911180 ATGCAAATGTATCAAATACGAGG + Intronic
1175582040 20:60107544-60107566 ATTGTATTGGATCACATAATGGG + Intergenic
1177698503 21:24605346-24605368 ATTCAAATGGAGAAAATGACAGG - Intergenic
1178129495 21:29555519-29555541 ATTTAAAAGGAGCAAACAATCGG - Intronic
1178353149 21:31887464-31887486 AATCAAATGGCTCAGAAAATGGG - Intronic
1178391149 21:32199358-32199380 ATTCAAATGGAAGAAGTAAGAGG - Intergenic
1178464920 21:32839329-32839351 ATTCAGATTAATGAAATAATCGG + Intergenic
1179461981 21:41542279-41542301 ATAGAAATGGATAAAATAATGGG + Intergenic
1180592548 22:16953615-16953637 ATTCAGATAGAGAAAATAATTGG - Intergenic
1181785217 22:25221864-25221886 GCTCAGAGGGATCAAATAATTGG - Intronic
1182513633 22:30838360-30838382 ATTCATATCTATGAAATAATTGG + Intronic
1184317296 22:43705451-43705473 CTCCAAATAGATCAGATAATAGG + Intronic
1184818728 22:46892674-46892696 ATTAAAATGCATTAAAAAATAGG - Intronic
949554649 3:5142568-5142590 GGTCAAATGGATCAAATTTTCGG - Intronic
951613393 3:24517510-24517532 ATTTAATTGGATAAATTAATTGG + Intergenic
951788052 3:26445300-26445322 CTTCAAATGTATTAAATAAAAGG + Intergenic
952244285 3:31568784-31568806 AACCAAATGTATCAAATGATTGG + Intronic
952503460 3:33986593-33986615 TCTAAAATGGATCAAAGAATTGG - Intergenic
952658095 3:35811132-35811154 ATTCATAGGGATAAAATAAAGGG + Intergenic
952698416 3:36298008-36298030 TTCCAGATGGATCAAATAAATGG + Intergenic
953888086 3:46729739-46729761 ATATAAATGGATCAAATCTTTGG + Intronic
955650884 3:61192571-61192593 CTTGAAATGGTTCAAACAATAGG - Intronic
956201320 3:66709229-66709251 AGTTAAGTGGATTAAATAATAGG + Intergenic
956581576 3:70819843-70819865 ATCCAAATGGGTAAAATAACAGG + Intergenic
958688527 3:97430133-97430155 ATTCAAACTGATGAAAAAATTGG + Intronic
959855842 3:111156903-111156925 ATACCAATAAATCAAATAATGGG - Intronic
960264150 3:115601417-115601439 ATTAAGATGGATGAAATGATTGG + Intergenic
960645881 3:119882526-119882548 TTTGAAATGCATCAAAAAATAGG - Intronic
962413202 3:135159659-135159681 GTTTAAATAGATCAAATAGTGGG + Intronic
962656231 3:137546358-137546380 ATTAAAATCGAACACATAATTGG + Intergenic
962706941 3:138052658-138052680 AGTGCAATGGATCAAATGATTGG - Intergenic
963239321 3:142987522-142987544 ATTAAAATAGACCAAAGAATGGG + Intronic
963574412 3:147041827-147041849 AGGGAAATGGATCAAATAAAGGG + Intergenic
964374220 3:156033821-156033843 ATTAAAATCCATCAAATTATTGG + Intergenic
964950177 3:162281448-162281470 ATTCATATGGAACCAATAAAAGG - Intergenic
965007231 3:163042301-163042323 ATTCAAAGGCAACAAAGAATTGG + Intergenic
965151422 3:164981716-164981738 ATTCAATTGGATAGAATAATAGG + Intronic
965163603 3:165167210-165167232 ACTAAAATTGATCACATAATTGG - Intergenic
965348177 3:167578130-167578152 ATTGAAATGGTTGAAAGAATTGG - Intronic
966049006 3:175590269-175590291 AATCAATTGAAACAAATAATTGG - Intronic
966228961 3:177629790-177629812 AATCAAAAGGATCAAATATTGGG + Intergenic
967958240 3:194895384-194895406 ATAAAAATGAATGAAATAATGGG - Intergenic
968436869 4:597164-597186 TTTAAAATTGATCACATAATTGG - Intergenic
970761751 4:19497714-19497736 CATCAAATAGATCAAATAGTTGG - Intergenic
971961096 4:33488044-33488066 ATTAAAATGATTCAAATTATAGG + Intergenic
972569305 4:40295849-40295871 ATTAATATGGATCAATTGATAGG - Intergenic
973590837 4:52439547-52439569 ATTCAACTGGAACATATAAAAGG + Intergenic
974651632 4:64760802-64760824 ATACAAATGAATTAAATAAATGG - Intergenic
974677147 4:65107133-65107155 ATTCAAATGGAAAACATAATGGG + Intergenic
975194480 4:71507818-71507840 TTTAAAATTGATCACATAATCGG + Intronic
975353268 4:73369591-73369613 ATTAAAATGGATAAAACACTTGG + Intergenic
975419652 4:74148013-74148035 CTTAAAATGGATCAAAGAAATGG - Intronic
975545888 4:75560137-75560159 ATTCCAATGGATTAAATAGGGGG + Intronic
975733728 4:77362028-77362050 ATTCAAATGCAGCAATTAACAGG - Intronic
976052656 4:81027735-81027757 ACTCAAATGGTTTAAATCATAGG - Intergenic
977007283 4:91584827-91584849 ATTCAGATGTCTCACATAATAGG - Intronic
977104598 4:92865383-92865405 ATTAAAATGGCACAAATAGTTGG + Intronic
977243962 4:94607199-94607221 TTTCAAATGGATTAAAAAATAGG - Intronic
977625725 4:99187793-99187815 ATTAAAATGGATAAAACACTTGG - Intergenic
978690117 4:111497878-111497900 ATTAAAATGAATCAGATATTGGG - Intergenic
979586899 4:122430881-122430903 ATTAAAAAGGATCAAAATATGGG + Intergenic
981528159 4:145728117-145728139 ATTCAAATTGATCACAGCATTGG - Intronic
983278068 4:165643207-165643229 TTTTTAATAGATCAAATAATAGG - Intergenic
983315808 4:166131973-166131995 TTTAAAATTGATCACATAATTGG - Intergenic
983331817 4:166339583-166339605 ATTAAGATGCAACAAATAATTGG - Intergenic
984227465 4:177052418-177052440 ATTCAAAGGGTTTTAATAATGGG - Intergenic
984273395 4:177576042-177576064 ATTTTAATGCATCAAATAAAAGG - Intergenic
984425866 4:179584786-179584808 ATTCATCTGGATCAAATTGTTGG + Intergenic
984846535 4:184112920-184112942 ATTCAAATCTATCAAGTATTTGG - Intronic
985325138 4:188759062-188759084 CTCCACATGGATAAAATAATTGG - Intergenic
986103054 5:4631653-4631675 ATTGAAATGGATCAAAGATCAGG - Intergenic
987252868 5:16118386-16118408 ATTCAACTGGTTCCAATAAGAGG + Intronic
987780868 5:22433292-22433314 ATTAAAATGTATCAAACAATTGG + Intronic
987834456 5:23143854-23143876 TTTCAAATTGACCACATAATTGG - Intergenic
988026969 5:25707622-25707644 TTTCAAATGATTCAAATGATTGG + Intergenic
988865250 5:35327080-35327102 TCTAAAATTGATCAAATAATTGG + Intergenic
990335292 5:54766456-54766478 ATTGAAATGTACCAAGTAATGGG - Intergenic
991227508 5:64290292-64290314 TCTAAAATTGATCAAATAATCGG - Intronic
992188759 5:74269325-74269347 ATTTAAATAAAGCAAATAATTGG - Intergenic
993164729 5:84338023-84338045 ATGCATAGTGATCAAATAATTGG + Intronic
993370127 5:87083018-87083040 ATTCCATTGTATCAAATCATTGG + Intergenic
993624022 5:90202010-90202032 ATTCTAATGGCTCAACTATTTGG - Intergenic
993881306 5:93364983-93365005 ATTGAAATGATTGAAATAATGGG - Intergenic
994301330 5:98151627-98151649 ACTCAACTGGTTCAAATAGTTGG - Intergenic
994693264 5:103044148-103044170 AATCAAATAAATCAAAGAATGGG + Intergenic
994764807 5:103902627-103902649 ATTCATATGGAACAAAAAAAGGG + Intergenic
995258053 5:110070368-110070390 ACTAAAATTGATCACATAATAGG - Intergenic
995402929 5:111761788-111761810 ATTGAATTGGATCTGATAATGGG + Intronic
997583181 5:135029892-135029914 ATTCAAAAGGATCAAAAATGGGG - Intronic
999598266 5:153230376-153230398 ATAAAAATGGATCATATCATAGG - Intergenic
1000430463 5:161146180-161146202 ATTCAAAGGCATCAAACCATAGG - Intergenic
1000612796 5:163393266-163393288 ATTCATATGGAACCAAAAATGGG + Intergenic
1001341068 5:170845995-170846017 ATGCAATTGGAATAAATAATTGG - Intergenic
1002588141 5:180265995-180266017 ATTAAAATGAAACAAAAAATGGG + Intronic
1003744967 6:8990413-8990435 ATTCCAATTGATGGAATAATAGG + Intergenic
1008462955 6:51797215-51797237 TTTAAAATTGATCATATAATTGG - Intronic
1008821790 6:55641668-55641690 ATTATAATGGCTGAAATAATTGG - Intergenic
1009426504 6:63519626-63519648 ATTCAATTGAGTCACATAATGGG - Intergenic
1009686002 6:66958639-66958661 GTTCATATGGAACCAATAATAGG - Intergenic
1010026434 6:71223242-71223264 AATCAGATTGATCAAATAACAGG + Intergenic
1010121092 6:72376892-72376914 CTTCAAATGGATCAAAATAAAGG + Intronic
1010274402 6:73952423-73952445 ATTGAAAAGGATGAAAAAATTGG - Intergenic
1010493753 6:76506638-76506660 TTTAAAATTGATCAAATAATTGG - Intergenic
1011097893 6:83686676-83686698 ATCCAAATGGATATAATCATTGG - Intronic
1011778823 6:90763280-90763302 ATTCAAATGGATCAAACAATGGG + Intergenic
1011922555 6:92598568-92598590 ATCCAAATGGAAACAATAATGGG + Intergenic
1012006522 6:93719667-93719689 TTTCAAATGTTTCAAATCATAGG - Intergenic
1012107909 6:95188899-95188921 ATTCAAATGACTCAATTGATAGG + Intergenic
1012667469 6:101992268-101992290 ATTCAAAGAAATCAAATAAGAGG - Intronic
1012689018 6:102291291-102291313 ATTATAATGGAAAAAATAATTGG + Intergenic
1015536926 6:134275892-134275914 ACCCAAATGGATGAAAGAATGGG - Intronic
1015761174 6:136662882-136662904 ATGCAACTGAATCAAATAAATGG - Intronic
1016490566 6:144596591-144596613 CATCAAATGAATCAAATAGTTGG + Intronic
1017075518 6:150614033-150614055 ATTTAAATGGATGAATGAATGGG + Intronic
1017774086 6:157667112-157667134 GTTCATATGTATCAAATATTAGG - Intronic
1017781836 6:157721430-157721452 ATTCAAAGGAATAAAATAACCGG + Intronic
1019204929 6:170352503-170352525 TCTAAAATGGATCACATAATCGG + Intronic
1020712374 7:11623911-11623933 AATAATATGTATCAAATAATTGG - Intronic
1021115313 7:16740264-16740286 AATCAAATGGATGGAATAATTGG - Intergenic
1023079136 7:36511454-36511476 ATTCAAATGTGTCAAAAAAGAGG + Intergenic
1027470946 7:78573591-78573613 ATCCAAAGGAAACAAATAATTGG - Intronic
1030463043 7:109864492-109864514 ATTCAAATGGAACAGATTGTAGG + Intergenic
1030512150 7:110495916-110495938 ATCAAAATGGATTAAACAATAGG - Intergenic
1030748441 7:113198648-113198670 TTTCTAATGGATAAACTAATTGG - Intergenic
1030850193 7:114474419-114474441 ATTTATATGGATCTAATACTAGG - Intronic
1030918697 7:115351561-115351583 ATACATATGGTTCAAAAAATCGG - Intergenic
1031652854 7:124312847-124312869 CTTAAAATGGAACAAATATTTGG - Intergenic
1031754119 7:125616405-125616427 ACTCAAATATATCAAACAATTGG - Intergenic
1032608620 7:133386937-133386959 TTTAAAATAGACCAAATAATGGG - Intronic
1032646214 7:133827294-133827316 ATTCAATTTGATCATATAATGGG - Intronic
1033059962 7:138096657-138096679 ATTGAAAGAGATCAAATAATAGG - Intronic
1033479555 7:141726005-141726027 TTTCTAATAGCTCAAATAATTGG - Intronic
1034152999 7:148931477-148931499 ATGCATATGGGTCAAATAAACGG + Intergenic
1034922104 7:155091791-155091813 ATTTAAATGGATCAAAGAGCTGG - Intergenic
1035439813 7:158887379-158887401 ATTCAGAATGAGCAAATAATTGG + Intronic
1038596202 8:28889164-28889186 AGTCAAATGGCTCAAATCAAAGG + Intronic
1039250732 8:35661282-35661304 TTTCTAATGGTTGAAATAATGGG + Intronic
1040547605 8:48411331-48411353 ATTCAAATGAATAAAATAAATGG + Intergenic
1040833221 8:51702179-51702201 AGACAAATGGATAAAATAACAGG - Intronic
1041165369 8:55086998-55087020 ATTCAAATGCAACACAAAATGGG + Intergenic
1041366595 8:57112552-57112574 AAACAAATGGATCAATTAAATGG + Intergenic
1042116881 8:65442076-65442098 CTTCAAATGGATGAAATAAGTGG + Intergenic
1042189897 8:66176054-66176076 ATTAAAATATATGAAATAATTGG - Intergenic
1042882113 8:73505141-73505163 CTCCAAAAGGATCAAAGAATGGG + Intronic
1042965239 8:74344286-74344308 ATTCACATGGATCAGATTACTGG + Intronic
1043287739 8:78555523-78555545 ATTCAAAAGGCTCAAAATATAGG + Intronic
1043298906 8:78702874-78702896 AATAAAATTGATCACATAATTGG - Intronic
1043465318 8:80500519-80500541 ATTCAAATGCATAACATATTTGG + Intronic
1043795477 8:84532514-84532536 ATTTTTATGGATGAAATAATAGG + Intronic
1043952437 8:86324186-86324208 TGTCAACTGGATGAAATAATGGG - Intergenic
1044129844 8:88508404-88508426 ATTCAAATAAATAAAATTATTGG + Intergenic
1044296327 8:90531627-90531649 ATTTAAATGTATCAAAACATAGG + Intergenic
1044896149 8:96893610-96893632 ATTCAGAGGGACAAAATAATTGG + Intronic
1046112781 8:109746603-109746625 ATCCAAAAGGATCACAGAATTGG + Intergenic
1046202560 8:110946549-110946571 AATCAAATATATCAAAGAATGGG + Intergenic
1047232947 8:123012775-123012797 AATGACATGGATCTAATAATAGG - Intergenic
1047319238 8:123764024-123764046 ATTCAAAGGGATTAAACCATAGG + Intergenic
1048403421 8:134094100-134094122 ATTCAAATTGAACAAATCATGGG - Intergenic
1048832987 8:138494695-138494717 AGTCAAATTGAGCAAATATTTGG + Intronic
1049914290 9:301740-301762 ATTCAAAAGGATAAAATAAATGG - Intronic
1050235693 9:3577031-3577053 ATTCAAATTAATAAGATAATTGG + Intergenic
1050367243 9:4883983-4884005 ATTCAAAAAGTTCAAATAAATGG - Intronic
1050932242 9:11344846-11344868 AATAAAATGGGTCAAAGAATTGG + Intergenic
1051151090 9:14079746-14079768 ATTCAAATGGAGAAAGTCATGGG - Intergenic
1051227132 9:14911027-14911049 ATGCAAATGGATCAGATTAATGG - Intergenic
1051358332 9:16260223-16260245 ATTCTAATGGATGATAAAATTGG - Intronic
1051776647 9:20641275-20641297 ATCCAGATGGATCATAGAATAGG - Intergenic
1055782004 9:79830500-79830522 ATTCAAATGGATGAGATGTTTGG - Intergenic
1055876325 9:80946288-80946310 ATTCAAATCTATCTAATTATGGG + Intergenic
1057719654 9:97521617-97521639 ATAGAAATGGATCAAGTGATGGG + Intronic
1057926492 9:99155862-99155884 ATTAAAAGGGATGAAATAGTAGG + Intergenic
1061413774 9:130434645-130434667 ATCCAAATGGATATATTAATTGG - Intergenic
1061827245 9:133266710-133266732 ATTCAAATGGCTGAAATGACTGG - Intronic
1062140337 9:134953652-134953674 ATTCAAATGAATCAAAGATTAGG - Intergenic
1062702611 9:137915399-137915421 GTTAAAATGGGTCAAATTATGGG + Intronic
1203491862 Un_GL000224v1:114394-114416 TCTAAAATGGATCACATAATTGG - Intergenic
1203504486 Un_KI270741v1:56265-56287 TCTAAAATGGATCACATAATTGG - Intergenic
1186095237 X:6093968-6093990 ATTTTAATAGATCAAAAAATAGG + Intronic
1187584534 X:20645529-20645551 ATTCATATGGAACTAATAAAGGG + Intergenic
1188638093 X:32461079-32461101 CTTCAAATGTATCAGATATTTGG + Intronic
1189866297 X:45331540-45331562 TTTCAATTAGATCAAATGATGGG + Intergenic
1189999089 X:46667846-46667868 ATGCAAACTGATCAAATTATAGG + Intronic
1190820882 X:53971065-53971087 TTTAAAATTGATCACATAATCGG + Intronic
1192856284 X:75016116-75016138 ATTTGAATTTATCAAATAATTGG - Intergenic
1193209600 X:78790594-78790616 TCTAAAATGGATGAAATAATCGG + Intergenic
1193343169 X:80376154-80376176 AATCAAATGGAATAAACAATTGG - Intronic
1193364914 X:80620843-80620865 TTTAGAATCGATCAAATAATTGG - Intergenic
1193386052 X:80872690-80872712 ATTTAAATGGAAGAAGTAATGGG - Intergenic
1194237997 X:91408720-91408742 ATCCAAATTGAAAAAATAATTGG + Intergenic
1194613121 X:96068135-96068157 ATATAAATGGATAAAAGAATGGG - Intergenic
1194664124 X:96658422-96658444 AATAAAATTGATCACATAATTGG + Intergenic
1195860439 X:109377295-109377317 CCTCAAATAGTTCAAATAATTGG + Intronic
1197149209 X:123202071-123202093 ATTTACATGAATCAAACAATTGG - Intronic
1197250458 X:124210393-124210415 ATGCAAATGCCTCAAATAATTGG - Intronic
1198369784 X:135979245-135979267 ATTCATGTGGAACAAAGAATAGG - Intergenic
1199589110 X:149449888-149449910 TTTAAAATTGATCACATAATTGG - Intergenic
1199638374 X:149835350-149835372 GTTGGAATGGATCAAATATTCGG + Intergenic
1201370563 Y:13258677-13258699 ATTAAAATGGATCAAAACACTGG + Intronic