ID: 934831138

View in Genome Browser
Species Human (GRCh38)
Location 2:97526208-97526230
Sequence TGCTGTGTGATCTTTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 2, 2: 5, 3: 49, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934831138 Original CRISPR TGCTGTGTGATCTTTCCTCT GGG (reversed) Intronic
900920219 1:5665375-5665397 GTCTGTGAAATCTTTCCTCTGGG + Intergenic
903018481 1:20377245-20377267 AGCTGTGTGACCTCACCTCTGGG + Intergenic
904107229 1:28095973-28095995 TCCTGTAGGATCTTTCCTGTGGG + Intergenic
905609067 1:39332923-39332945 TGCTGTTTGGTCTTCCCTTTGGG - Intronic
906069796 1:43008178-43008200 TGATGTCTGAGCTTCCCTCTCGG + Intergenic
906570074 1:46830519-46830541 TTCTGCCTGATCCTTCCTCTGGG + Intergenic
906842992 1:49160412-49160434 TGCTGCCTGATCCTTCCTCAAGG + Intronic
907969851 1:59369718-59369740 TGCTGTCTGATCATTCTTCTGGG - Intronic
909129835 1:71720939-71720961 TGCTGACTGATGTTTTCTCTAGG - Intronic
909427622 1:75545450-75545472 TTCTGTATGATGTTTCCACTTGG + Intronic
909709257 1:78626386-78626408 TAGTGTGTGCTTTTTCCTCTTGG + Intronic
910063934 1:83129616-83129638 TGCTGTGTGATTGTTCCCCCAGG - Intergenic
910398485 1:86814556-86814578 AGCTGCCTGATCATTCCTCTGGG - Intergenic
910453670 1:87372710-87372732 TGCTCTGGGAACTGTCCTCTAGG + Intergenic
911650414 1:100381849-100381871 TGCTGTTTGGTCTTTCCCCTAGG + Intronic
912209234 1:107540671-107540693 TGCTGTGAGTTCTATCTTCTAGG + Intergenic
915695436 1:157736850-157736872 AGCTGTGTGATCTTATTTCTGGG + Intergenic
916590956 1:166189647-166189669 CTCTGTGTGGTCTTTCCTGTAGG - Intergenic
916899038 1:169200832-169200854 TGCAGTGTGCACTGTCCTCTTGG + Intronic
917444195 1:175092962-175092984 TCCTGTGTGACCTTCACTCTTGG + Intronic
917682674 1:177384252-177384274 TGCTGCCTGCTCCTTCCTCTGGG + Intergenic
918616515 1:186550656-186550678 TGCTGCCTGATCCTTTCTCTGGG + Intergenic
919762865 1:201109195-201109217 GGCTGTGTGATCTCGGCTCTCGG - Intronic
920996448 1:210996788-210996810 TGCTGCCTGATCGTTCCTCTGGG - Intronic
923504011 1:234590080-234590102 TGCTCTGCCCTCTTTCCTCTTGG + Intergenic
1063245617 10:4215046-4215068 TGCTGTGAGATCCACCCTCTGGG + Intergenic
1063425242 10:5945612-5945634 AGCTGTGTCTTCATTCCTCTGGG - Intronic
1065906848 10:30262639-30262661 TCCTGTGAGATCTCTCTTCTTGG - Intergenic
1067172505 10:43920119-43920141 TGCTGCCTGATCCTTCCTCTGGG + Intergenic
1067328908 10:45295805-45295827 TGCAGTGTGGTGATTCCTCTAGG - Intergenic
1067681174 10:48442227-48442249 TGCTTTGTCATCTGTCCTGTGGG + Intergenic
1068201188 10:53786413-53786435 CGCTGTTTAATCTTCCCTCTAGG + Intergenic
1069360547 10:67636668-67636690 TGCTGCCTGATCTTTCCTCTGGG - Intronic
1069865327 10:71498864-71498886 CAATGTCTGATCTTTCCTCTGGG + Intronic
1071368689 10:84928090-84928112 AGCTCTGTGATCTTTCTTCCAGG - Intergenic
1072084878 10:92068912-92068934 TTCTGAGTGTTGTTTCCTCTAGG + Intronic
1074091358 10:110261045-110261067 AGCAGTGTGCTCTTTCCTCCTGG - Intronic
1074165497 10:110871175-110871197 TTCTCTGTGACTTTTCCTCTTGG - Intergenic
1075983821 10:126766393-126766415 TGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1076187668 10:128461707-128461729 TGCTCTGTGCTCCTCCCTCTGGG + Intergenic
1076882375 10:133245812-133245834 TGCTGCCTGATCTTTCCCCTCGG + Intergenic
1077144148 11:1037240-1037262 CGCTGGGTGATCTTTCCTGTTGG - Intergenic
1077669282 11:4143057-4143079 TGCAGTGGGATCCTTCCTCAAGG - Intergenic
1079024267 11:16933693-16933715 GGCTTTGTGACTTTTCCTCTTGG - Intronic
1079381553 11:19942652-19942674 TGGTGTCTCATCTTTCCTTTTGG - Intronic
1081143756 11:39536150-39536172 TGCTGCCTGATCCCTCCTCTGGG + Intergenic
1081562347 11:44229311-44229333 TGCTGTGTTCTCTCTACTCTGGG - Intronic
1081742906 11:45453443-45453465 TCCTGTATAATCTTTCCCCTTGG - Intergenic
1083513657 11:63235980-63236002 TGCTGCCTGATCATTCCTCTGGG + Intronic
1084238421 11:67803144-67803166 CGCTGTGTGATCTCTCCCCGGGG + Intergenic
1085230939 11:74969633-74969655 TCCTGTAGGATCTTTCCTGTGGG - Exonic
1085800779 11:79586861-79586883 TGCTGCCTGATCCTTCCTCTGGG - Intergenic
1087280740 11:96207203-96207225 TGTTGTGTGCTCTTTCTGCTGGG + Intronic
1087643868 11:100785073-100785095 TGCTGTTTTCTCCTTCCTCTTGG - Intronic
1088082973 11:105942221-105942243 TCCTGTGCCATTTTTCCTCTGGG - Intronic
1088294381 11:108276712-108276734 TGCTGCCTGTTCCTTCCTCTGGG + Intronic
1091634405 12:2186263-2186285 AGCTGTGTGGTCGGTCCTCTCGG + Intronic
1092683404 12:11014781-11014803 GGATGTGTGTCCTTTCCTCTGGG - Intronic
1092687666 12:11069964-11069986 GGATGTGTGTCCTTTCCTCTGGG - Intronic
1092911518 12:13149209-13149231 TGCTGTGTCGTCTATCCTCTGGG + Intergenic
1093179203 12:15949036-15949058 TGCTGTCTGATCGTTCCTCTGGG + Intronic
1093340383 12:17966949-17966971 GGCTGCCTGTTCTTTCCTCTGGG + Intergenic
1094312414 12:29098804-29098826 TGCAGTGTGACCCCTCCTCTTGG + Intergenic
1097435477 12:59548733-59548755 TGCTGCCTGTTCTTTTCTCTGGG + Intergenic
1100115180 12:91295002-91295024 GGCTGTCTGCTCCTTCCTCTGGG - Intergenic
1100456739 12:94759196-94759218 TTCTGGGTTTTCTTTCCTCTTGG + Intergenic
1101250471 12:102929322-102929344 TGCTGTGAGAACTTTTCCCTAGG + Intronic
1102155243 12:110721089-110721111 TGCTTTGTGATCATACCCCTTGG + Exonic
1102670221 12:114611963-114611985 TCCTGTGTGATGTAACCTCTGGG - Intergenic
1103281536 12:119761814-119761836 TACTGTTTTATGTTTCCTCTTGG - Intronic
1103514300 12:121497078-121497100 TGCTGTTTGCTGTTTCCTGTGGG - Intronic
1103935914 12:124476430-124476452 TGCTCTGTTATCTCTCTTCTTGG - Intronic
1104051866 12:125200340-125200362 TGCTGTGTATTTTTTCCTGTAGG + Intronic
1106184245 13:27394908-27394930 TTTGGTTTGATCTTTCCTCTAGG + Intergenic
1106459825 13:29959139-29959161 TGCTGTGTCAGCTTGGCTCTGGG - Intergenic
1107850483 13:44567479-44567501 TTCTATGTGGTGTTTCCTCTAGG - Intronic
1108194335 13:47976607-47976629 AGCTGTGTCAACTTCCCTCTGGG - Intronic
1108294717 13:49002272-49002294 TTGAGTGTGATCTTTCCTGTAGG + Intronic
1108797089 13:54044620-54044642 TGCTGCCTGATCCTTCCTCTTGG - Intergenic
1109067233 13:57712879-57712901 TACTGTCTGTTCTTTGCTCTGGG + Intronic
1109081806 13:57912697-57912719 ATCTGTGTGCTTTTTCCTCTGGG - Intergenic
1109588253 13:64439234-64439256 TTATGTGTGATTTTTCCTCTTGG - Intergenic
1110729792 13:78866657-78866679 TGCTGTCTGATCCTTCCTCTTGG - Intergenic
1110959989 13:81609299-81609321 TGCTGTGTGTGCTCTCCTGTGGG - Intergenic
1111676295 13:91393929-91393951 TGCTGTGTAGTCTCTCCTTTAGG + Intergenic
1112736537 13:102426946-102426968 GGCTGTGTGAACTTACCTCGAGG - Intergenic
1112751132 13:102584432-102584454 TCCTGTTTGATATTTCCACTTGG - Intergenic
1113156737 13:107331939-107331961 TGCTGAGTGAATTTTGCTCTTGG - Intronic
1113344891 13:109467675-109467697 TGCTGTTTGGTCTTTGCCCTGGG - Intergenic
1114083225 14:19219409-19219431 TGCTGTGTGATGCCCCCTCTTGG + Intergenic
1115895561 14:38082808-38082830 TGCTCTGTGTTCCTTCCACTGGG - Intergenic
1116428695 14:44820883-44820905 GGCTGCCTGCTCTTTCCTCTGGG - Intergenic
1116524690 14:45890211-45890233 TTCAGTATGATCTTTCCCCTGGG - Intergenic
1116942511 14:50804505-50804527 TGCTGTGTGTTCCATCCTTTGGG - Intronic
1117445137 14:55797065-55797087 GCCTGTTTGTTCTTTCCTCTGGG + Intergenic
1117546177 14:56796367-56796389 TGCTGTTTGACTTTCCCTCTAGG + Intergenic
1120036706 14:79706121-79706143 TGCTCTTGGATCTTTGCTCTAGG + Intronic
1120561799 14:86003541-86003563 TTCTGTGAGATCTTTCATTTTGG + Intergenic
1121718338 14:96091816-96091838 AGCTGTGGGCTCTGTCCTCTGGG - Exonic
1122052374 14:99068590-99068612 TGCTGTGTCATCTTTATTTTGGG + Intergenic
1123044018 14:105502778-105502800 TGGTGTTTGCTCTTCCCTCTGGG - Intergenic
1123104020 14:105828738-105828760 AGGGGTGTGAACTTTCCTCTTGG + Intergenic
1125555078 15:40578120-40578142 TTGTGTGTGATGTTACCTCTGGG + Intergenic
1126067357 15:44836347-44836369 TGCTGTGTCACCTTCACTCTGGG + Intergenic
1126951158 15:53883339-53883361 TGCTTTGAAATATTTCCTCTTGG + Intergenic
1127524958 15:59784030-59784052 TGCTGCCTGATCCTTCCTCTGGG + Intergenic
1127574775 15:60280429-60280451 TGCTGTGTGAACATTACTCAGGG - Intergenic
1127813921 15:62589928-62589950 TCCTGTCTGATTTTTCCTCCTGG + Intronic
1128525277 15:68408084-68408106 TCTTGTGTGAGTTTTCCTCTAGG + Intronic
1129037374 15:72658781-72658803 TGCTGCGTGCTCCTTGCTCTGGG - Intronic
1129116292 15:73367295-73367317 CGCTGGGGGAACTTTCCTCTGGG - Intronic
1129212513 15:74078444-74078466 TGCTGCGTGCTCCTTGCTCTGGG + Intronic
1129397886 15:75262635-75262657 TGCTGCGTGCTCCTTGCTCTGGG - Intronic
1129401497 15:75286916-75286938 TGCTGCGTGCTCCTTGCTCTGGG - Intronic
1129729649 15:77922763-77922785 TGCTGCGTGCTCCTTGCTCTGGG + Intergenic
1129838876 15:78731219-78731241 TGCTGTGTGCTCCTTGCTCTGGG - Intergenic
1130905903 15:88240777-88240799 TGCTGTGTGATGACTGCTCTGGG - Intronic
1131486503 15:92825278-92825300 TGCTGTGTGATCTTTACTATGGG - Intergenic
1132044654 15:98553436-98553458 TGCAGTGAGATTGTTCCTCTTGG + Intergenic
1134258901 16:12634699-12634721 TGTAGTGAGATTTTTCCTCTGGG - Intergenic
1136779946 16:32891628-32891650 TGTTGCCTGATCCTTCCTCTGGG - Intergenic
1136890667 16:33969892-33969914 TGTTGCCTGATCCTTCCTCTGGG + Intergenic
1137347262 16:47675669-47675691 TGCTTTGGGATCATTCCACTGGG - Intronic
1137999650 16:53262536-53262558 TCCTGTGTTATATTTCCTTTAGG + Intronic
1138692823 16:58785210-58785232 TGCTGCCTGATCGTTCCTCTCGG + Intergenic
1139947294 16:70650101-70650123 TGTTGTGGGTTCTTACCTCTGGG + Intronic
1141318860 16:82987850-82987872 TGCTTTGTGATTCTGCCTCTTGG + Intronic
1203082365 16_KI270728v1_random:1153716-1153738 TGTTGCCTGATCCTTCCTCTGGG - Intergenic
1148147651 17:45376211-45376233 GGCTGTGTGATCCATCGTCTTGG - Intergenic
1148954129 17:51339316-51339338 TTCTGTGTGATCTGTGATCTAGG + Intergenic
1151412277 17:73939022-73939044 TGCAGTTTGCTCTTTCCTGTAGG - Intergenic
1152633530 17:81421204-81421226 GGCTGAGGGCTCTTTCCTCTTGG - Intronic
1152830790 17:82495984-82496006 TGCTTTGGGATGTGTCCTCTAGG - Intergenic
1155076616 18:22362849-22362871 AGTTGTGTGATTTCTCCTCTTGG + Intergenic
1156735259 18:40249828-40249850 TGCTGCTTTATTTTTCCTCTTGG + Intergenic
1157033421 18:43941760-43941782 TACTGTCTGATGTTTCCTATAGG - Intergenic
1157859127 18:51125184-51125206 TGCAGTGTGACCCCTCCTCTTGG - Intergenic
1158866451 18:61642406-61642428 TGCTGTGTGAGAATTTCTCTGGG + Intergenic
1159546721 18:69848607-69848629 GTCTGTGTGATTTTTCCCCTTGG + Exonic
1159938524 18:74387771-74387793 GCCTTTGTGATCTTTCCTCTTGG + Intergenic
1160182902 18:76651078-76651100 TTCTGAGTGATCCTTCTTCTTGG + Intergenic
1160332970 18:78012238-78012260 ACCTGTGTTATCTTTCCTTTTGG + Intergenic
1163234530 19:16022958-16022980 TGCTGTGGGATGTCCCCTCTGGG - Intergenic
1164906128 19:31969703-31969725 CCCTGTGAGTTCTTTCCTCTTGG - Intergenic
1165287913 19:34858163-34858185 TGCTGTCTGATCGTTCCTCCTGG - Intergenic
1167125594 19:47546107-47546129 TGCTGGGTGGTCTTTCCTCGTGG - Intronic
1167783051 19:51612967-51612989 TGCTGTGCTATCTTCTCTCTGGG + Intronic
925018570 2:551234-551256 TGATGTGAGCTATTTCCTCTCGG + Intergenic
925600274 2:5601676-5601698 TGATGTGTGCTTATTCCTCTGGG - Intergenic
925699616 2:6622316-6622338 TGCTGTGAGAACTCTCTTCTGGG - Intergenic
926216206 2:10907126-10907148 TTCTCTGTGAGCTTTCCCCTAGG + Intergenic
928239998 2:29577968-29577990 TGCATTGGGCTCTTTCCTCTAGG + Intronic
931198226 2:60073276-60073298 TGCTGTGTGATTTTTCCATATGG + Intergenic
932229142 2:70068124-70068146 TGGTGTCTGATCTCTCCTCCTGG - Intergenic
933322416 2:80793913-80793935 TGCTATGTGATCCTTCTTGTAGG - Intergenic
933900555 2:86846665-86846687 TGCTGTGAGTTGTCTCCTCTTGG - Exonic
934627190 2:95870319-95870341 TGCTGTGTGATCGTTCCTCTGGG - Intronic
934729019 2:96644625-96644647 TACTGTGTCCTCTTTTCTCTTGG - Intergenic
934806372 2:97230976-97230998 TGCTGTGTGATCGTTCCTCTGGG + Intronic
934831138 2:97526208-97526230 TGCTGTGTGATCTTTCCTCTGGG - Intronic
934899427 2:98146107-98146129 TGCTTTGTGTTCTTTCCTCAGGG + Intronic
935035464 2:99367885-99367907 TTCTGTGTGAACATTTCTCTTGG - Intronic
935350619 2:102149414-102149436 TGCCGTCTGTTCTCTCCTCTTGG + Intronic
935779992 2:106502560-106502582 TGCTGTGAGTTGTCTCCTCTTGG + Intergenic
935805481 2:106743164-106743186 AGCTGTGTTATGTTTTCTCTTGG + Intergenic
936262065 2:110968649-110968671 AGCTATCTGATCTTTCTTCTGGG - Intronic
936430627 2:112459307-112459329 TGGGGAGTGATCTTTCCTCTAGG + Intergenic
937528849 2:122804348-122804370 TTCTATGAGATGTTTCCTCTTGG - Intergenic
937768329 2:125688302-125688324 TGCTGTCAGATCTTTCCTTCAGG - Intergenic
938493357 2:131777221-131777243 TGCTGTGTGATGCCCCCTCTTGG - Intergenic
938636453 2:133232506-133232528 TGCTGGGTTTTCTTTCCTTTTGG - Intronic
938874333 2:135517622-135517644 TGCTGCCTGTTCCTTCCTCTGGG + Intronic
939605126 2:144245354-144245376 TTCTGAGTGATCATTCATCTTGG + Intronic
940683180 2:156812061-156812083 TGCTGTAGGGTCTTTCTTCTGGG + Intergenic
945486805 2:210406561-210406583 TGCTGCCTGTTCTTTCCTCTGGG + Intergenic
945752943 2:213810965-213810987 AGCTGTTTGATCCTTCTTCTGGG + Intronic
946814383 2:223561412-223561434 TGCTGTGAGATCTCTCTTCTGGG - Intergenic
1169681362 20:8217591-8217613 TGCAGTGTGATTTTTCCAGTAGG + Intronic
1170870920 20:20205608-20205630 TGCAGTTTGAATTTTCCTCTTGG + Intronic
1171120532 20:22564847-22564869 TGGTGTGTTGTCTTTCCTCAGGG - Intergenic
1171982204 20:31636116-31636138 TGCTGTGTTTTCCTGCCTCTGGG + Intergenic
1172710851 20:36922037-36922059 TTCAGTGTGATGTTTCCTCATGG - Intronic
1174740073 20:53004393-53004415 TGCTGTATCATCTTACGTCTTGG - Intronic
1176988725 21:15468287-15468309 TCCTGTGTGATCCTTCATCTAGG - Intergenic
1177245997 21:18524624-18524646 TCCTGTCTGATTTTTCATCTCGG - Intergenic
1177789226 21:25704554-25704576 TGCTATGTAATATTTTCTCTAGG + Intronic
1179836339 21:44036405-44036427 TGCTGAGAGATTTTTCCTCTAGG + Intronic
1180250288 21:46581800-46581822 GGCTGCCTGATCCTTCCTCTGGG + Intergenic
1180294748 22:10873858-10873880 TGCTGTGTGATGCCCCCTCTTGG - Intergenic
1180497554 22:15903272-15903294 TGCTGTGTGATGCCCCCTCTTGG - Intergenic
1182952402 22:34390165-34390187 TGCTGTCTGTTCCTTCCTCTTGG + Intergenic
1183072467 22:35406108-35406130 TGCTGTGTGGTCTTCTGTCTGGG - Intronic
950331618 3:12160180-12160202 TGCTGTGGGATGTTTCCACATGG + Intronic
950781507 3:15396823-15396845 TGCTACTTGATCATTCCTCTGGG + Intronic
951153049 3:19315241-19315263 TGCCCTGTGATCCTACCTCTTGG - Intronic
957427647 3:80060629-80060651 TTCTATAGGATCTTTCCTCTTGG - Intergenic
957942047 3:87017897-87017919 TGCTGCCTGATCATTCCTCCGGG - Intergenic
959347713 3:105220416-105220438 TGCTGTCTTCTTTTTCCTCTGGG - Intergenic
959844015 3:111012310-111012332 TTCTGGATGATCTTTCCTTTTGG - Intergenic
962039974 3:131696616-131696638 TGATGTGTGCTTTTTCCTTTAGG - Exonic
962145063 3:132832140-132832162 GGCTGTGTGAGCCTTCATCTAGG - Intergenic
962906786 3:139810868-139810890 TGCAGTGTGATCCTTTCTTTTGG + Intergenic
963650683 3:147976424-147976446 GTCTGTCTGATATTTCCTCTGGG + Intergenic
964013321 3:151917136-151917158 TGGTGTGTGATCTTTATTCATGG + Intergenic
965337937 3:167450759-167450781 TGCTTTTTGGTCTTTCCTCTTGG - Intronic
965570866 3:170171395-170171417 TGCTGTGTGACACTTCCTGTGGG + Exonic
965731988 3:171781891-171781913 GGCTGTGTTTTCTTTTCTCTTGG - Intronic
965958521 3:174400793-174400815 AGCTGTGTGATCTTATTTCTGGG + Intergenic
966137986 3:176722492-176722514 TGCAGTGTAAGGTTTCCTCTGGG - Intergenic
966419716 3:179725481-179725503 TGCTCTGTTAATTTTCCTCTAGG + Intronic
966457304 3:180132278-180132300 TGGTGTGTGATTTTCACTCTGGG - Intergenic
966583084 3:181590766-181590788 TGCTGCCTGATCCTTCCTCTGGG + Intergenic
968498071 4:929479-929501 TGCTGTGTGTTCTTTGTTTTGGG - Intronic
968944603 4:3657021-3657043 TTTTGTGTCTTCTTTCCTCTGGG - Intergenic
969638182 4:8381521-8381543 TGCTTCCTGATCTTTTCTCTTGG + Exonic
970165025 4:13227473-13227495 AGCTGCCTGCTCTTTCCTCTAGG - Intergenic
970814965 4:20144410-20144432 TTCTGTATGATATTTCCTGTAGG - Intergenic
971238317 4:24864026-24864048 TGCTGAGAGATCTTTTGTCTCGG + Intronic
972883169 4:43449629-43449651 TGTAGTGTGGTCCTTCCTCTAGG + Intergenic
974905683 4:68053706-68053728 TGCTGTGTCTTCTTCCCTCATGG + Exonic
975064246 4:70041245-70041267 TGCTGCCTGATCCTTCCTCTGGG + Intergenic
976508939 4:85884576-85884598 TTCTGGGTTAGCTTTCCTCTGGG + Intronic
976671450 4:87658912-87658934 TCCTGTGTTACGTTTCCTCTAGG + Intronic
977099018 4:92784878-92784900 AGCTGTGTCATCTTTTCTTTAGG + Intronic
982328059 4:154149915-154149937 TGCTGCCTGATTGTTCCTCTGGG + Intergenic
983988669 4:174091912-174091934 TGGTGTGTGATGTTCCCTCCCGG + Intergenic
984061266 4:174991277-174991299 TGTAGTGGGATCTTTCCTCAAGG + Intergenic
984062338 4:175005423-175005445 TGTTCAGTAATCTTTCCTCTGGG + Intergenic
984126681 4:175818861-175818883 TTGTGTTTCATCTTTCCTCTAGG + Intronic
984129837 4:175860708-175860730 TGATGAGTGATCTTTACTGTTGG - Intronic
984470957 4:180172842-180172864 TGCTGTGGGATCTTTCTACTTGG + Intergenic
985082616 4:186281585-186281607 TGTGGTGTGTTCTTTCCTGTTGG - Intronic
987106469 5:14644787-14644809 TGGTGTGTGCTCCTTCCTTTTGG - Intergenic
988445989 5:31286653-31286675 TGCAGTGTCCTCTTTACTCTTGG - Intronic
989442855 5:41493268-41493290 TGCTGTCTGATCGTTCCTCTGGG + Intronic
990901041 5:60749182-60749204 CTCTGTGTGGTCTTTCCCCTTGG - Intergenic
990913785 5:60881198-60881220 TGCTAGCTGATCGTTCCTCTGGG + Intronic
991082595 5:62617090-62617112 TGCTCAGTGATCTTGCTTCTTGG + Intronic
991110650 5:62896182-62896204 TGCTGCCTGCTCTTTCGTCTGGG + Intergenic
992155643 5:73952818-73952840 TCCTTTTTGATTTTTCCTCTGGG + Intergenic
992254785 5:74911114-74911136 TGCTGCCTGCTCTTTCTTCTGGG + Intergenic
992758638 5:79932460-79932482 TGCTGTATGCTCTCTTCTCTAGG - Intergenic
993420951 5:87700556-87700578 GGCTGCCTGCTCTTTCCTCTGGG + Intergenic
993671613 5:90767193-90767215 GGCAGTGTGATATTTGCTCTGGG + Intronic
993714608 5:91263268-91263290 TGATGTGTGATGTTAGCTCTAGG - Intergenic
993731595 5:91429225-91429247 TGCTTTGGGTTCTATCCTCTGGG + Intergenic
995181993 5:109238089-109238111 TGGTGTGTCAACTCTCCTCTAGG + Intergenic
996320037 5:122205207-122205229 TGTTGCCTGATCGTTCCTCTGGG - Intergenic
996956860 5:129193609-129193631 TGCTGTATGATTTTTCCCATAGG - Intergenic
998544794 5:143017843-143017865 TCCTGTGTGAGAATTCCTCTGGG + Intronic
998749776 5:145307303-145307325 TGCTGTGTGAGCCTCCCTCAGGG - Intergenic
999938658 5:156516316-156516338 GGCTGTCTGCTCCTTCCTCTGGG - Intronic
1000799165 5:165703124-165703146 TTCAGTGTGGTCATTCCTCTGGG + Intergenic
1001356640 5:171032517-171032539 TGCTGTGTGAACTTTTATATAGG + Intronic
1001372527 5:171220238-171220260 TGCTGCCTAATCTTTCCTCTGGG + Intronic
1001534155 5:172486851-172486873 TGCTGTGTCTGGTTTCCTCTGGG - Intergenic
1001949207 5:175804378-175804400 TGATGTGTGATCCTTTCTCTGGG - Intronic
1002769834 6:281392-281414 GGCTGAGGGATTTTTCCTCTTGG + Intergenic
1003397942 6:5769570-5769592 TGCTCTGTGGACATTCCTCTGGG - Intronic
1003486986 6:6588444-6588466 TGATGCGTGAACTTACCTCTTGG - Exonic
1007970380 6:46046193-46046215 TGATGTGTAACTTTTCCTCTTGG + Intronic
1008851062 6:56022279-56022301 TTCTGTGTGGTCTTTCTTCTTGG + Intergenic
1009290187 6:61870666-61870688 TGCTGCCTGTTCTTTCCTCTGGG - Intronic
1009652151 6:66489856-66489878 TGCTGCCTATTCTTTCCTCTGGG - Intergenic
1010617796 6:78034216-78034238 TACTTTCTGATCTTTCCTGTGGG + Intergenic
1011139052 6:84133198-84133220 TGCTGCCTGATCCTTCCTCTGGG + Intronic
1011250170 6:85363060-85363082 TGCTGTGTGATCTGTCCAAAAGG - Intergenic
1011377568 6:86706482-86706504 AGCTGCCTGCTCTTTCCTCTGGG + Intergenic
1011614354 6:89184388-89184410 TGCTCTGTGACCTTTCTCCTGGG - Intronic
1012075109 6:94673000-94673022 AGCTGTCTGCTCCTTCCTCTGGG - Intergenic
1012642810 6:101641777-101641799 TGCTTTTTGATCTTTGCTGTAGG - Intronic
1012862750 6:104580158-104580180 TGTTTTGTGATTGTTCCTCTTGG - Intergenic
1013067239 6:106695614-106695636 TTCTGTGTGATCTCTCCACCTGG - Intergenic
1014732005 6:125043248-125043270 TGCTGTGTTCTCTTTCCTCCAGG + Intronic
1014842275 6:126234233-126234255 AGCTGTGTGAACTTTCAACTAGG - Intergenic
1015103859 6:129513194-129513216 CACTGTGTGATTTTTCTTCTTGG - Intronic
1015174394 6:130290906-130290928 TGCTGTTTTCCCTTTCCTCTGGG + Intronic
1015357879 6:132300970-132300992 TTCTGTCTGCTCTTTTCTCTAGG - Intronic
1018141506 6:160842093-160842115 TTCACTGTCATCTTTCCTCTGGG + Intergenic
1018141703 6:160844200-160844222 TGCACTGTCATCTTTCCTCTGGG + Intergenic
1018141883 6:160846133-160846155 TTCAGTGTCATCTTTTCTCTGGG + Intergenic
1018142017 6:160847497-160847519 TGCACTGTCATCTTTTCTCTGGG - Intergenic
1018142069 6:160848133-160848155 TGCACTGTCATCTTTCCTCCGGG - Intergenic
1018142187 6:160849481-160849503 AGCAATGTCATCTTTCCTCTGGG - Intergenic
1018142520 6:160853372-160853394 TGCGCTGTCATCTTTTCTCTGGG + Intergenic
1018142760 6:160856058-160856080 TGCCCTGTCATCTTTTCTCTTGG + Intergenic
1019227725 6:170528633-170528655 TGTTCTCTGATCCTTCCTCTGGG + Intergenic
1019262121 7:87560-87582 TGCTGGGAGATGCTTCCTCTAGG + Intergenic
1019930862 7:4222182-4222204 AGCTTTGGGGTCTTTCCTCTTGG - Intronic
1021187064 7:17576468-17576490 TGCTGCTTGCTCTTCCCTCTGGG - Intergenic
1021224482 7:18012253-18012275 TGCTGCCTGTTTTTTCCTCTGGG + Intergenic
1021753405 7:23827931-23827953 TGCTGCCTGATCGTTCCTCTGGG + Intronic
1022025213 7:26441966-26441988 TCCTGTGTGACCTCTCCTTTTGG + Intergenic
1025173708 7:56784672-56784694 TCATGTGTTAACTTTCCTCTGGG + Intergenic
1025698390 7:63793481-63793503 TCATGTGTTAACTTTCCTCTGGG - Intergenic
1026312606 7:69200267-69200289 GGCTGTGTGCTCTTGCCTATGGG - Intergenic
1026456243 7:70575032-70575054 TGCTGGGTAATCGTTCCGCTCGG + Intronic
1026549636 7:71357125-71357147 TGTTGTGTCATCTGGCCTCTGGG + Intronic
1026581823 7:71624926-71624948 TGCCATGTGATGTGTCCTCTAGG + Intronic
1026926122 7:74195164-74195186 GTCTCTGTGCTCTTTCCTCTGGG - Exonic
1026992381 7:74594494-74594516 TGCTGGCAAATCTTTCCTCTGGG - Intronic
1027620250 7:80475815-80475837 TGAGGTGTGATTTTTACTCTCGG - Intronic
1028517168 7:91690754-91690776 AGCTGTTTTATCTTTCCTCTTGG - Intergenic
1028892620 7:96005413-96005435 TTCTCTGTGATTTTTCATCTTGG + Intronic
1030890090 7:114989082-114989104 TGCACTGTGACCTCTCCTCTAGG - Intronic
1031691305 7:124791236-124791258 TGCTGTATAATCCTTTCTCTGGG - Intergenic
1031982633 7:128137383-128137405 TTCTGTGTGATGTTTACTCATGG - Intergenic
1034040038 7:147868316-147868338 TGCTGCATGATCCTTCCTCTGGG + Intronic
1034228408 7:149500297-149500319 TGCTTTATGATTTTTCTTCTAGG - Intergenic
1035351846 7:158252728-158252750 TGCTGTGTGATTTTGCTGCTTGG - Intronic
1036282183 8:7409749-7409771 TGCTGTGTGAGCTTTGACCTTGG + Intergenic
1036339285 8:7901822-7901844 TGCTGTGTGAGCTTTGACCTTGG - Intergenic
1036628065 8:10488557-10488579 TTCAGTGTGATATTTCCTCACGG + Intergenic
1036940752 8:13049490-13049512 TTCCCTGTGATCTTTTCTCTGGG + Intergenic
1037256892 8:16965466-16965488 TGATGTGAGATCATTCCTCAAGG + Intergenic
1037704570 8:21308466-21308488 CACTGTGAGATCTTTCTTCTTGG - Intergenic
1038102753 8:24397265-24397287 TGATGTGTGAAGTATCCTCTGGG - Exonic
1038710825 8:29943556-29943578 TGCTTTGTCATTTTTGCTCTTGG - Intergenic
1039300117 8:36200583-36200605 GGCTGTCTGATCATTCCTCTGGG + Intergenic
1039602609 8:38853398-38853420 TGCTGTGTTTTGTTTCTTCTAGG + Intergenic
1040431671 8:47349315-47349337 TGCTGCCTGATCCTTCCTCTGGG + Intronic
1041435517 8:57836292-57836314 TGAGGTGTGTTCCTTCCTCTTGG - Intergenic
1041791590 8:61702108-61702130 TGCTATGTTATATTTTCTCTTGG - Intronic
1041840792 8:62268410-62268432 TCCAGTGTGATCTATCCTCTGGG + Intronic
1042872099 8:73408589-73408611 AGCTGTGTCATCTTTATTCTAGG - Intergenic
1043129332 8:76441760-76441782 TGCTGCCTGATCCTTCCTCTGGG + Intergenic
1043827446 8:84946511-84946533 TGCTGAGTGAGCTTGTCTCTTGG - Intergenic
1043939622 8:86182289-86182311 TCCTCTGTGATCTAGCCTCTCGG + Intergenic
1044294003 8:90506219-90506241 TGCTGAGTGATCTTGTCCCTCGG + Intergenic
1044505069 8:93007135-93007157 GGCTGCCTGATCCTTCCTCTGGG - Intronic
1044615558 8:94136988-94137010 TGCTGCCTGATCCTTCCTCTGGG + Intronic
1045794261 8:106024106-106024128 TGCTGCCTAATCGTTCCTCTGGG - Intergenic
1046341855 8:112869466-112869488 TGCAGTGTGGTGTTTCCTCAAGG + Intronic
1047295703 8:123568908-123568930 AGCTGTTTCTTCTTTCCTCTGGG + Intergenic
1047572345 8:126113141-126113163 AGCTGTGTGATCTGTGATCTTGG + Intergenic
1050478202 9:6062991-6063013 TGTTGCCTGATCCTTCCTCTGGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051639320 9:19210124-19210146 TGCTTTGTTCTCTTTCCACTTGG + Intergenic
1051872904 9:21759268-21759290 TGCTGTATGAGATTTCCACTGGG + Intergenic
1052628033 9:31002666-31002688 TGCTGCCTGACCGTTCCTCTGGG + Intergenic
1053278355 9:36800122-36800144 TGCTGTGTGATCTTCCTGTTTGG + Intergenic
1055534699 9:77227902-77227924 TGTTCTGTGATCTTTTTTCTGGG + Intronic
1055837500 9:80461193-80461215 TTCTGTATACTCTTTCCTCTTGG - Intergenic
1056705108 9:88945362-88945384 TACTGAGTGCTCTTTCTTCTGGG - Intergenic
1058639928 9:107073683-107073705 TGTTCTGTGAACTTTCCTTTTGG + Intergenic
1059004125 9:110383430-110383452 GGCTGCCTGCTCTTTCCTCTGGG + Intronic
1060720406 9:125972732-125972754 TGCTGTGTGATCTTGGCCATGGG + Intergenic
1060988270 9:127833125-127833147 TGCTGTGTTCTTTTTCTTCTTGG - Intronic
1061921716 9:133786334-133786356 TGCTGTGTGAGCTCTCCTGTGGG + Intronic
1185686171 X:1930567-1930589 TGCTGTGGGATCTTTTTTATTGG + Intergenic
1185887222 X:3793425-3793447 TGCTCTGAGATTTTACCTCTTGG + Intergenic
1186221504 X:7354222-7354244 TGCTCCCTGATATTTCCTCTTGG + Exonic
1186319138 X:8405185-8405207 TGCAGAATGATCTTTCCCCTTGG + Intergenic
1186585525 X:10869200-10869222 TTCTATGTTATCTTGCCTCTGGG - Intergenic
1189674328 X:43445093-43445115 TGCTGTTTGGTCCCTCCTCTTGG - Intergenic
1190649814 X:52557763-52557785 TTCTGTAAGACCTTTCCTCTAGG + Intergenic
1190975614 X:55397311-55397333 TGCTGCCTGATCATTCCTCTGGG - Intergenic
1190979581 X:55443998-55444020 TGCTACCTGATCCTTCCTCTGGG - Intergenic
1192707500 X:73541683-73541705 TGCTGTCTGCTCATTCCTCTGGG - Intergenic
1192870134 X:75176833-75176855 TGCAGTTTGATCTTTTCTGTAGG - Intergenic
1193055407 X:77144193-77144215 TGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1193113678 X:77755681-77755703 TGCTGCCTGCTCCTTCCTCTGGG + Intronic
1193284923 X:79700848-79700870 TGTTGTATGATGTTTCCTTTTGG + Intergenic
1193641037 X:84009596-84009618 TGCTGCCTGATCCTTCCTCTGGG - Intergenic
1193687245 X:84592234-84592256 GGCTGTCTGCTCCTTCCTCTGGG - Intergenic
1194207522 X:91029669-91029691 TGCTGAGTGAATTTTTCTCTAGG - Intergenic
1194640104 X:96393546-96393568 TGCTGTGCTAGCTTGCCTCTTGG + Intergenic
1195323156 X:103737330-103737352 TGCTTTGTGACATTTCCCCTTGG + Intergenic
1195812747 X:108851971-108851993 GGCTGCCTGTTCTTTCCTCTAGG - Intergenic
1196490455 X:116259442-116259464 TGCTGTCTTATCTTTTCTCTAGG + Intergenic
1197107437 X:122732508-122732530 GGCAGTGTGTTCCTTCCTCTGGG - Intergenic
1197174557 X:123471559-123471581 TGCAATGGCATCTTTCCTCTTGG - Intronic
1197493500 X:127148727-127148749 TGCTGTATCTTTTTTCCTCTGGG - Intergenic
1198332739 X:135636752-135636774 TGCAGCATGATCTTTCCTCAAGG - Intergenic
1198365269 X:135933618-135933640 TGCAGCATGATCTTTCCTCAAGG - Intergenic
1199968453 X:152840654-152840676 TGCTGCCTGATCCTTCCTCTGGG + Intronic
1200553319 Y:4604715-4604737 TGCTGAGTGAATTTTTCTCTAGG - Intergenic
1201907353 Y:19099467-19099489 TGCTCTGAGATTTTACCTCTTGG - Intergenic