ID: 934836054

View in Genome Browser
Species Human (GRCh38)
Location 2:97590392-97590414
Sequence CCGGGCATGGGCTTCGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836054_934836066 15 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836054_934836065 10 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836065 2:97590425-97590447 GCAGACTGCCTGACTTGCCGCGG No data
934836054_934836072 27 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836072 2:97590442-97590464 CCGCGGCCAGGCTGGCCCCGGGG No data
934836054_934836069 25 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836069 2:97590440-97590462 TGCCGCGGCCAGGCTGGCCCCGG No data
934836054_934836070 26 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836054_934836068 19 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836054 Original CRISPR CCGGGCATGGGCTTCGGCCG GGG (reversed) Intergenic