ID: 934836066

View in Genome Browser
Species Human (GRCh38)
Location 2:97590430-97590452
Sequence CTGCCTGACTTGCCGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836061_934836066 -3 Left 934836061 2:97590410-97590432 CCCGGCGCTCCTGCCGCAGACTG No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836059_934836066 3 Left 934836059 2:97590404-97590426 CCCATGCCCGGCGCTCCTGCCGC No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836062_934836066 -4 Left 934836062 2:97590411-97590433 CCGGCGCTCCTGCCGCAGACTGC No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836054_934836066 15 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836056_934836066 14 Left 934836056 2:97590393-97590415 CCCGGCCGAAGCCCATGCCCGGC No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836052_934836066 22 Left 934836052 2:97590385-97590407 CCTGCACCCCCGGCCGAAGCCCA No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836057_934836066 13 Left 934836057 2:97590394-97590416 CCGGCCGAAGCCCATGCCCGGCG No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836060_934836066 2 Left 934836060 2:97590405-97590427 CCATGCCCGGCGCTCCTGCCGCA No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836058_934836066 9 Left 934836058 2:97590398-97590420 CCGAAGCCCATGCCCGGCGCTCC No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836051_934836066 25 Left 934836051 2:97590382-97590404 CCTCCTGCACCCCCGGCCGAAGC No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data
934836053_934836066 16 Left 934836053 2:97590391-97590413 CCCCCGGCCGAAGCCCATGCCCG No data
Right 934836066 2:97590430-97590452 CTGCCTGACTTGCCGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836066 Original CRISPR CTGCCTGACTTGCCGCGGCC AGG Intergenic