ID: 934836067

View in Genome Browser
Species Human (GRCh38)
Location 2:97590433-97590455
Sequence CAGCCTGGCCGCGGCAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836067_934836080 8 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836080 2:97590464-97590486 GTCCGCGCGGCTGGAGGCGCAGG No data
934836067_934836074 -5 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836074 2:97590451-97590473 GGCTGGCCCCGGGGTCCGCGCGG No data
934836067_934836084 18 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836084 2:97590474-97590496 CTGGAGGCGCAGGCCTGGTCGGG No data
934836067_934836078 2 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836078 2:97590458-97590480 CCCGGGGTCCGCGCGGCTGGAGG No data
934836067_934836082 13 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836082 2:97590469-97590491 CGCGGCTGGAGGCGCAGGCCTGG No data
934836067_934836075 -1 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836075 2:97590455-97590477 GGCCCCGGGGTCCGCGCGGCTGG No data
934836067_934836085 19 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836085 2:97590475-97590497 TGGAGGCGCAGGCCTGGTCGGGG No data
934836067_934836083 17 Left 934836067 2:97590433-97590455 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934836083 2:97590473-97590495 GCTGGAGGCGCAGGCCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836067 Original CRISPR CAGCCTGGCCGCGGCAAGTC AGG (reversed) Intergenic