ID: 934836068

View in Genome Browser
Species Human (GRCh38)
Location 2:97590434-97590456
Sequence CTGACTTGCCGCGGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836051_934836068 29 Left 934836051 2:97590382-97590404 CCTCCTGCACCCCCGGCCGAAGC No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836058_934836068 13 Left 934836058 2:97590398-97590420 CCGAAGCCCATGCCCGGCGCTCC No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836054_934836068 19 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836056_934836068 18 Left 934836056 2:97590393-97590415 CCCGGCCGAAGCCCATGCCCGGC No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836052_934836068 26 Left 934836052 2:97590385-97590407 CCTGCACCCCCGGCCGAAGCCCA No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836062_934836068 0 Left 934836062 2:97590411-97590433 CCGGCGCTCCTGCCGCAGACTGC No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836061_934836068 1 Left 934836061 2:97590410-97590432 CCCGGCGCTCCTGCCGCAGACTG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836053_934836068 20 Left 934836053 2:97590391-97590413 CCCCCGGCCGAAGCCCATGCCCG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836060_934836068 6 Left 934836060 2:97590405-97590427 CCATGCCCGGCGCTCCTGCCGCA No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836063_934836068 -8 Left 934836063 2:97590419-97590441 CCTGCCGCAGACTGCCTGACTTG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836059_934836068 7 Left 934836059 2:97590404-97590426 CCCATGCCCGGCGCTCCTGCCGC No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data
934836057_934836068 17 Left 934836057 2:97590394-97590416 CCGGCCGAAGCCCATGCCCGGCG No data
Right 934836068 2:97590434-97590456 CTGACTTGCCGCGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836068 Original CRISPR CTGACTTGCCGCGGCCAGGC TGG Intergenic