ID: 934836070

View in Genome Browser
Species Human (GRCh38)
Location 2:97590441-97590463
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836056_934836070 25 Left 934836056 2:97590393-97590415 CCCGGCCGAAGCCCATGCCCGGC No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836064_934836070 -5 Left 934836064 2:97590423-97590445 CCGCAGACTGCCTGACTTGCCGC No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836053_934836070 27 Left 934836053 2:97590391-97590413 CCCCCGGCCGAAGCCCATGCCCG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836059_934836070 14 Left 934836059 2:97590404-97590426 CCCATGCCCGGCGCTCCTGCCGC No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836060_934836070 13 Left 934836060 2:97590405-97590427 CCATGCCCGGCGCTCCTGCCGCA No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836062_934836070 7 Left 934836062 2:97590411-97590433 CCGGCGCTCCTGCCGCAGACTGC No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836058_934836070 20 Left 934836058 2:97590398-97590420 CCGAAGCCCATGCCCGGCGCTCC No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836054_934836070 26 Left 934836054 2:97590392-97590414 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836057_934836070 24 Left 934836057 2:97590394-97590416 CCGGCCGAAGCCCATGCCCGGCG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836063_934836070 -1 Left 934836063 2:97590419-97590441 CCTGCCGCAGACTGCCTGACTTG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data
934836061_934836070 8 Left 934836061 2:97590410-97590432 CCCGGCGCTCCTGCCGCAGACTG No data
Right 934836070 2:97590441-97590463 GCCGCGGCCAGGCTGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type