ID: 934836132

View in Genome Browser
Species Human (GRCh38)
Location 2:97590669-97590691
Sequence CTTGGCACTCCGCAGCCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836124_934836132 4 Left 934836124 2:97590642-97590664 CCCACGCCCAGAGCGCAGGACCT No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836121_934836132 18 Left 934836121 2:97590628-97590650 CCAGCTGCTCCTGACCCACGCCC No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836122_934836132 9 Left 934836122 2:97590637-97590659 CCTGACCCACGCCCAGAGCGCAG No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836125_934836132 3 Left 934836125 2:97590643-97590665 CCACGCCCAGAGCGCAGGACCTG No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836127_934836132 -2 Left 934836127 2:97590648-97590670 CCCAGAGCGCAGGACCTGGCGCT No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836128_934836132 -3 Left 934836128 2:97590649-97590671 CCAGAGCGCAGGACCTGGCGCTT No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836120_934836132 23 Left 934836120 2:97590623-97590645 CCTTGCCAGCTGCTCCTGACCCA No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data
934836119_934836132 24 Left 934836119 2:97590622-97590644 CCCTTGCCAGCTGCTCCTGACCC No data
Right 934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836132 Original CRISPR CTTGGCACTCCGCAGCCACC GGG Intergenic