ID: 934836483

View in Genome Browser
Species Human (GRCh38)
Location 2:97594157-97594179
Sequence CTGGTGACTCAAAGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934836482_934836483 -5 Left 934836482 2:97594139-97594161 CCTAATACAGTAAAGAAACTGGT No data
Right 934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934836483 Original CRISPR CTGGTGACTCAAAGAGAGAA AGG Intergenic
No off target data available for this crispr