ID: 934838102

View in Genome Browser
Species Human (GRCh38)
Location 2:97607841-97607863
Sequence CCAGGCAGGAGAGGCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838102_934838113 22 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838113 2:97607886-97607908 GCCTCCATGAGGGTTCCTGAAGG No data
934838102_934838117 27 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data
934838102_934838116 26 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG No data
934838102_934838112 12 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838102_934838108 -10 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838108 2:97607854-97607876 TCCTGCCTGGCAGAAAGTGGGGG No data
934838102_934838111 11 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838102 Original CRISPR CCAGGCAGGAGAGGCTGCTG AGG (reversed) Intergenic