ID: 934838109

View in Genome Browser
Species Human (GRCh38)
Location 2:97607855-97607877
Sequence TCCCCCACTTTCTGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838109_934838111 -3 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838109_934838112 -2 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838109_934838117 13 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data
934838109_934838119 24 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838119 2:97607902-97607924 CTGAAGGCTGGGTGTTCACTTGG No data
934838109_934838113 8 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838113 2:97607886-97607908 GCCTCCATGAGGGTTCCTGAAGG No data
934838109_934838116 12 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838109 Original CRISPR TCCCCCACTTTCTGCCAGGC AGG (reversed) Intergenic