ID: 934838111

View in Genome Browser
Species Human (GRCh38)
Location 2:97607875-97607897
Sequence GGAAGAGAACTGCCTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838109_934838111 -3 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838110_934838111 -7 Left 934838110 2:97607859-97607881 CCTGGCAGAAAGTGGGGGAAGAG No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838101_934838111 28 Left 934838101 2:97607824-97607846 CCAGGTCATTGCTGCAGCCTCAG No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838102_934838111 11 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838100_934838111 29 Left 934838100 2:97607823-97607845 CCCAGGTCATTGCTGCAGCCTCA No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data
934838104_934838111 2 Left 934838104 2:97607850-97607872 CCTCTCCTGCCTGGCAGAAAGTG No data
Right 934838111 2:97607875-97607897 GGAAGAGAACTGCCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838111 Original CRISPR GGAAGAGAACTGCCTCCATG AGG Intergenic