ID: 934838112

View in Genome Browser
Species Human (GRCh38)
Location 2:97607876-97607898
Sequence GAAGAGAACTGCCTCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838104_934838112 3 Left 934838104 2:97607850-97607872 CCTCTCCTGCCTGGCAGAAAGTG No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838110_934838112 -6 Left 934838110 2:97607859-97607881 CCTGGCAGAAAGTGGGGGAAGAG No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838100_934838112 30 Left 934838100 2:97607823-97607845 CCCAGGTCATTGCTGCAGCCTCA No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838109_934838112 -2 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838101_934838112 29 Left 934838101 2:97607824-97607846 CCAGGTCATTGCTGCAGCCTCAG No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data
934838102_934838112 12 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838112 2:97607876-97607898 GAAGAGAACTGCCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838112 Original CRISPR GAAGAGAACTGCCTCCATGA GGG Intergenic