ID: 934838117

View in Genome Browser
Species Human (GRCh38)
Location 2:97607891-97607913
Sequence CATGAGGGTTCCTGAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838109_934838117 13 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data
934838110_934838117 9 Left 934838110 2:97607859-97607881 CCTGGCAGAAAGTGGGGGAAGAG No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data
934838102_934838117 27 Left 934838102 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data
934838104_934838117 18 Left 934838104 2:97607850-97607872 CCTCTCCTGCCTGGCAGAAAGTG No data
Right 934838117 2:97607891-97607913 CATGAGGGTTCCTGAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838117 Original CRISPR CATGAGGGTTCCTGAAGGCT GGG Intergenic