ID: 934838119

View in Genome Browser
Species Human (GRCh38)
Location 2:97607902-97607924
Sequence CTGAAGGCTGGGTGTTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838109_934838119 24 Left 934838109 2:97607855-97607877 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934838119 2:97607902-97607924 CTGAAGGCTGGGTGTTCACTTGG No data
934838110_934838119 20 Left 934838110 2:97607859-97607881 CCTGGCAGAAAGTGGGGGAAGAG No data
Right 934838119 2:97607902-97607924 CTGAAGGCTGGGTGTTCACTTGG No data
934838114_934838119 -8 Left 934838114 2:97607887-97607909 CCTCCATGAGGGTTCCTGAAGGC No data
Right 934838119 2:97607902-97607924 CTGAAGGCTGGGTGTTCACTTGG No data
934838104_934838119 29 Left 934838104 2:97607850-97607872 CCTCTCCTGCCTGGCAGAAAGTG No data
Right 934838119 2:97607902-97607924 CTGAAGGCTGGGTGTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838119 Original CRISPR CTGAAGGCTGGGTGTTCACT TGG Intergenic