ID: 934838960

View in Genome Browser
Species Human (GRCh38)
Location 2:97613350-97613372
Sequence GCGCCTTGTTCAAGATCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934838960_934838966 15 Left 934838960 2:97613350-97613372 CCCTATGATCTTGAACAAGGCGC No data
Right 934838966 2:97613388-97613410 CTCAGTGCCTCATCTGTAAGAGG No data
934838960_934838967 16 Left 934838960 2:97613350-97613372 CCCTATGATCTTGAACAAGGCGC No data
Right 934838967 2:97613389-97613411 TCAGTGCCTCATCTGTAAGAGGG No data
934838960_934838968 19 Left 934838960 2:97613350-97613372 CCCTATGATCTTGAACAAGGCGC No data
Right 934838968 2:97613392-97613414 GTGCCTCATCTGTAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934838960 Original CRISPR GCGCCTTGTTCAAGATCATA GGG (reversed) Intergenic
No off target data available for this crispr