ID: 934839441

View in Genome Browser
Species Human (GRCh38)
Location 2:97616016-97616038
Sequence GGTGAGCCCCGGCCCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839441_934839455 28 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839441_934839451 23 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839441_934839454 27 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839454 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
934839441_934839444 -4 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839441_934839456 29 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839456 2:97616068-97616090 AAGACACTACCCCATGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839441 Original CRISPR GGTGAGCCCCGGCCCAAGCA GGG (reversed) Intergenic