ID: 934839443

View in Genome Browser
Species Human (GRCh38)
Location 2:97616027-97616049
Sequence CTGTAAGGGCTGGTGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839443_934839454 16 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839454 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
934839443_934839455 17 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839443_934839456 18 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839456 2:97616068-97616090 AAGACACTACCCCATGGCAGGGG No data
934839443_934839461 29 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839443_934839451 12 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839443_934839459 28 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839443_934839462 30 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839443 Original CRISPR CTGTAAGGGCTGGTGAGCCC CGG (reversed) Intergenic
No off target data available for this crispr