ID: 934839444

View in Genome Browser
Species Human (GRCh38)
Location 2:97616035-97616057
Sequence CACCAGCCCTTACAGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839433_934839444 20 Left 934839433 2:97615992-97616014 CCTGAGCCACAGGGCACTGCCTA No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839442_934839444 -5 Left 934839442 2:97616017-97616039 CCTGCTTGGGCCGGGGCTCACCA No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839431_934839444 29 Left 934839431 2:97615983-97616005 CCACTCAGGCCTGAGCCACAGGG No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839440_934839444 1 Left 934839440 2:97616011-97616033 CCTAGCCCTGCTTGGGCCGGGGC No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839441_934839444 -4 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data
934839434_934839444 14 Left 934839434 2:97615998-97616020 CCACAGGGCACTGCCTAGCCCTG No data
Right 934839444 2:97616035-97616057 CACCAGCCCTTACAGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839444 Original CRISPR CACCAGCCCTTACAGACAGC AGG Intergenic
No off target data available for this crispr