ID: 934839445

View in Genome Browser
Species Human (GRCh38)
Location 2:97616037-97616059
Sequence GGCCTGCTGTCTGTAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839445_934839456 8 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839456 2:97616068-97616090 AAGACACTACCCCATGGCAGGGG No data
934839445_934839461 19 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839445_934839454 6 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839454 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
934839445_934839459 18 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839445_934839451 2 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839445_934839455 7 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839445_934839462 20 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839445 Original CRISPR GGCCTGCTGTCTGTAAGGGC TGG (reversed) Intergenic