ID: 934839446

View in Genome Browser
Species Human (GRCh38)
Location 2:97616041-97616063
Sequence GCGGGGCCTGCTGTCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839446_934839456 4 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839456 2:97616068-97616090 AAGACACTACCCCATGGCAGGGG No data
934839446_934839455 3 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839446_934839454 2 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839454 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
934839446_934839451 -2 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839446_934839461 15 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839446_934839462 16 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data
934839446_934839459 14 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839446 Original CRISPR GCGGGGCCTGCTGTCTGTAA GGG (reversed) Intergenic