ID: 934839449

View in Genome Browser
Species Human (GRCh38)
Location 2:97616059-97616081
Sequence TGGGGTAGTGTCTTGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839449_934839459 -4 Left 934839449 2:97616059-97616081 CCCGCCTCCAAGACACTACCCCA No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839449_934839462 -2 Left 934839449 2:97616059-97616081 CCCGCCTCCAAGACACTACCCCA No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data
934839449_934839461 -3 Left 934839449 2:97616059-97616081 CCCGCCTCCAAGACACTACCCCA No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839449_934839464 15 Left 934839449 2:97616059-97616081 CCCGCCTCCAAGACACTACCCCA No data
Right 934839464 2:97616097-97616119 TTGGGGTCCCCATAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839449 Original CRISPR TGGGGTAGTGTCTTGGAGGC GGG (reversed) Intergenic