ID: 934839450

View in Genome Browser
Species Human (GRCh38)
Location 2:97616060-97616082
Sequence ATGGGGTAGTGTCTTGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839450_934839459 -5 Left 934839450 2:97616060-97616082 CCGCCTCCAAGACACTACCCCAT No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839450_934839464 14 Left 934839450 2:97616060-97616082 CCGCCTCCAAGACACTACCCCAT No data
Right 934839464 2:97616097-97616119 TTGGGGTCCCCATAAAATGCAGG No data
934839450_934839462 -3 Left 934839450 2:97616060-97616082 CCGCCTCCAAGACACTACCCCAT No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data
934839450_934839461 -4 Left 934839450 2:97616060-97616082 CCGCCTCCAAGACACTACCCCAT No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839450 Original CRISPR ATGGGGTAGTGTCTTGGAGG CGG (reversed) Intergenic