ID: 934839451

View in Genome Browser
Species Human (GRCh38)
Location 2:97616062-97616084
Sequence GCCTCCAAGACACTACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839441_934839451 23 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839447_934839451 -3 Left 934839447 2:97616042-97616064 CCTTACAGACAGCAGGCCCCGCC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839446_934839451 -2 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839442_934839451 22 Left 934839442 2:97616017-97616039 CCTGCTTGGGCCGGGGCTCACCA No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839445_934839451 2 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839443_934839451 12 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data
934839440_934839451 28 Left 934839440 2:97616011-97616033 CCTAGCCCTGCTTGGGCCGGGGC No data
Right 934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839451 Original CRISPR GCCTCCAAGACACTACCCCA TGG Intergenic
No off target data available for this crispr