ID: 934839452

View in Genome Browser
Species Human (GRCh38)
Location 2:97616063-97616085
Sequence GCCATGGGGTAGTGTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839452_934839459 -8 Left 934839452 2:97616063-97616085 CCTCCAAGACACTACCCCATGGC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839452_934839464 11 Left 934839452 2:97616063-97616085 CCTCCAAGACACTACCCCATGGC No data
Right 934839464 2:97616097-97616119 TTGGGGTCCCCATAAAATGCAGG No data
934839452_934839461 -7 Left 934839452 2:97616063-97616085 CCTCCAAGACACTACCCCATGGC No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839452_934839462 -6 Left 934839452 2:97616063-97616085 CCTCCAAGACACTACCCCATGGC No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839452 Original CRISPR GCCATGGGGTAGTGTCTTGG AGG (reversed) Intergenic