ID: 934839453

View in Genome Browser
Species Human (GRCh38)
Location 2:97616066-97616088
Sequence CCTGCCATGGGGTAGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839453_934839462 -9 Left 934839453 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
Right 934839462 2:97616080-97616102 CATGGCAGGGGAAAGCCTTGGGG No data
934839453_934839464 8 Left 934839453 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
Right 934839464 2:97616097-97616119 TTGGGGTCCCCATAAAATGCAGG No data
934839453_934839461 -10 Left 934839453 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
Right 934839461 2:97616079-97616101 CCATGGCAGGGGAAAGCCTTGGG No data
934839453_934839468 29 Left 934839453 2:97616066-97616088 CCAAGACACTACCCCATGGCAGG No data
Right 934839468 2:97616118-97616140 GGCATCGCCAGACAGAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839453 Original CRISPR CCTGCCATGGGGTAGTGTCT TGG (reversed) Intergenic