ID: 934839455

View in Genome Browser
Species Human (GRCh38)
Location 2:97616067-97616089
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839446_934839455 3 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839447_934839455 2 Left 934839447 2:97616042-97616064 CCTTACAGACAGCAGGCCCCGCC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839441_934839455 28 Left 934839441 2:97616016-97616038 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839443_934839455 17 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839442_934839455 27 Left 934839442 2:97616017-97616039 CCTGCTTGGGCCGGGGCTCACCA No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data
934839445_934839455 7 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839455 2:97616067-97616089 CAAGACACTACCCCATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type