ID: 934839459

View in Genome Browser
Species Human (GRCh38)
Location 2:97616078-97616100
Sequence CCCATGGCAGGGGAAAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839445_934839459 18 Left 934839445 2:97616037-97616059 CCAGCCCTTACAGACAGCAGGCC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839449_934839459 -4 Left 934839449 2:97616059-97616081 CCCGCCTCCAAGACACTACCCCA No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839446_934839459 14 Left 934839446 2:97616041-97616063 CCCTTACAGACAGCAGGCCCCGC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839443_934839459 28 Left 934839443 2:97616027-97616049 CCGGGGCTCACCAGCCCTTACAG No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839450_934839459 -5 Left 934839450 2:97616060-97616082 CCGCCTCCAAGACACTACCCCAT No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839452_934839459 -8 Left 934839452 2:97616063-97616085 CCTCCAAGACACTACCCCATGGC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839448_934839459 -3 Left 934839448 2:97616058-97616080 CCCCGCCTCCAAGACACTACCCC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data
934839447_934839459 13 Left 934839447 2:97616042-97616064 CCTTACAGACAGCAGGCCCCGCC No data
Right 934839459 2:97616078-97616100 CCCATGGCAGGGGAAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839459 Original CRISPR CCCATGGCAGGGGAAAGCCT TGG Intergenic
No off target data available for this crispr