ID: 934839489

View in Genome Browser
Species Human (GRCh38)
Location 2:97616195-97616217
Sequence CTCCAGTAGCAGCCAGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934839483_934839489 -8 Left 934839483 2:97616180-97616202 CCTGGATACCCTGCCCTCCAGTA No data
Right 934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG No data
934839481_934839489 -4 Left 934839481 2:97616176-97616198 CCACCCTGGATACCCTGCCCTCC No data
Right 934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG No data
934839473_934839489 27 Left 934839473 2:97616145-97616167 CCCAGGATGGGAAGATTTACTTA No data
Right 934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG No data
934839474_934839489 26 Left 934839474 2:97616146-97616168 CCAGGATGGGAAGATTTACTTAG No data
Right 934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG No data
934839482_934839489 -7 Left 934839482 2:97616179-97616201 CCCTGGATACCCTGCCCTCCAGT No data
Right 934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934839489 Original CRISPR CTCCAGTAGCAGCCAGGTTC CGG Intergenic
No off target data available for this crispr