ID: 934840502

View in Genome Browser
Species Human (GRCh38)
Location 2:97621337-97621359
Sequence CTCCCAGGGACTGCCGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934840502_934840507 7 Left 934840502 2:97621337-97621359 CCTGTGCCGGCAGTCCCTGGGAG No data
Right 934840507 2:97621367-97621389 AGAAGCCTAGAGCCCAGGAGCGG No data
934840502_934840509 16 Left 934840502 2:97621337-97621359 CCTGTGCCGGCAGTCCCTGGGAG No data
Right 934840509 2:97621376-97621398 GAGCCCAGGAGCGGAGCCAGTGG No data
934840502_934840506 2 Left 934840502 2:97621337-97621359 CCTGTGCCGGCAGTCCCTGGGAG No data
Right 934840506 2:97621362-97621384 GCAGCAGAAGCCTAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934840502 Original CRISPR CTCCCAGGGACTGCCGGCAC AGG (reversed) Intergenic
No off target data available for this crispr