ID: 934843626

View in Genome Browser
Species Human (GRCh38)
Location 2:97647060-97647082
Sequence TCAGTGGGAACACCACCTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843626_934843631 -4 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843631 2:97647079-97647101 CTGATGAAGAGCAGGCGACTGGG 0: 1
1: 0
2: 0
3: 8
4: 135
934843626_934843633 5 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843633 2:97647088-97647110 AGCAGGCGACTGGGTTGGAGAGG 0: 1
1: 2
2: 5
3: 18
4: 223
934843626_934843630 -5 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843630 2:97647078-97647100 ACTGATGAAGAGCAGGCGACTGG 0: 1
1: 0
2: 0
3: 5
4: 103
934843626_934843635 18 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843635 2:97647101-97647123 GTTGGAGAGGGAGATCATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 320
934843626_934843634 6 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843634 2:97647089-97647111 GCAGGCGACTGGGTTGGAGAGGG 0: 1
1: 2
2: 2
3: 21
4: 254
934843626_934843636 30 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843636 2:97647113-97647135 GATCATGCTGGCTGCAAAGAAGG 0: 1
1: 1
2: 17
3: 115
4: 795
934843626_934843632 0 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843632 2:97647083-97647105 TGAAGAGCAGGCGACTGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843626 Original CRISPR TCAGTGGGAACACCACCTAA AGG (reversed) Exonic