ID: 934843629

View in Genome Browser
Species Human (GRCh38)
Location 2:97647076-97647098
Sequence AGTCGCCTGCTCTTCATCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843629_934843634 -10 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843634 2:97647089-97647111 GCAGGCGACTGGGTTGGAGAGGG 0: 1
1: 2
2: 2
3: 21
4: 254
934843629_934843638 20 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843638 2:97647119-97647141 GCTGGCTGCAAAGAAGGGACTGG 0: 1
1: 0
2: 0
3: 32
4: 297
934843629_934843639 25 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843639 2:97647124-97647146 CTGCAAAGAAGGGACTGGTAAGG 0: 1
1: 0
2: 1
3: 20
4: 227
934843629_934843636 14 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843636 2:97647113-97647135 GATCATGCTGGCTGCAAAGAAGG 0: 1
1: 1
2: 17
3: 115
4: 795
934843629_934843635 2 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843635 2:97647101-97647123 GTTGGAGAGGGAGATCATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 320
934843629_934843637 15 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843637 2:97647114-97647136 ATCATGCTGGCTGCAAAGAAGGG 0: 1
1: 0
2: 3
3: 37
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843629 Original CRISPR AGTCGCCTGCTCTTCATCAG TGG (reversed) Exonic