ID: 934843630

View in Genome Browser
Species Human (GRCh38)
Location 2:97647078-97647100
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843626_934843630 -5 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843630 2:97647078-97647100 ACTGATGAAGAGCAGGCGACTGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type