ID: 934843631

View in Genome Browser
Species Human (GRCh38)
Location 2:97647079-97647101
Sequence CTGATGAAGAGCAGGCGACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843626_934843631 -4 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843631 2:97647079-97647101 CTGATGAAGAGCAGGCGACTGGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843631 Original CRISPR CTGATGAAGAGCAGGCGACT GGG Exonic