ID: 934843631 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:97647079-97647101 |
Sequence | CTGATGAAGAGCAGGCGACT GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 144 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 135} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
934843626_934843631 | -4 | Left | 934843626 | 2:97647060-97647082 | CCTTTAGGTGGTGTTCCCACTGA | 0: 1 1: 0 2: 0 3: 9 4: 69 |
||
Right | 934843631 | 2:97647079-97647101 | CTGATGAAGAGCAGGCGACTGGG | 0: 1 1: 0 2: 0 3: 8 4: 135 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
934843631 | Original CRISPR | CTGATGAAGAGCAGGCGACT GGG | Exonic | ||