ID: 934843632 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:97647083-97647105 |
| Sequence | TGAAGAGCAGGCGACTGGGT TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 180 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 168} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934843626_934843632 | 0 | Left | 934843626 | 2:97647060-97647082 | CCTTTAGGTGGTGTTCCCACTGA | 0: 1 1: 0 2: 0 3: 9 4: 69 |
||
| Right | 934843632 | 2:97647083-97647105 | TGAAGAGCAGGCGACTGGGTTGG | 0: 1 1: 0 2: 0 3: 11 4: 168 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934843632 | Original CRISPR | TGAAGAGCAGGCGACTGGGT TGG | Exonic | ||