ID: 934843632

View in Genome Browser
Species Human (GRCh38)
Location 2:97647083-97647105
Sequence TGAAGAGCAGGCGACTGGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843626_934843632 0 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843632 2:97647083-97647105 TGAAGAGCAGGCGACTGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843632 Original CRISPR TGAAGAGCAGGCGACTGGGT TGG Exonic