ID: 934843633

View in Genome Browser
Species Human (GRCh38)
Location 2:97647088-97647110
Sequence AGCAGGCGACTGGGTTGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 2, 2: 5, 3: 18, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843626_934843633 5 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843633 2:97647088-97647110 AGCAGGCGACTGGGTTGGAGAGG 0: 1
1: 2
2: 5
3: 18
4: 223
934843628_934843633 -10 Left 934843628 2:97647075-97647097 CCCACTGATGAAGAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934843633 2:97647088-97647110 AGCAGGCGACTGGGTTGGAGAGG 0: 1
1: 2
2: 5
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843633 Original CRISPR AGCAGGCGACTGGGTTGGAG AGG Exonic