ID: 934843634

View in Genome Browser
Species Human (GRCh38)
Location 2:97647089-97647111
Sequence GCAGGCGACTGGGTTGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843628_934843634 -9 Left 934843628 2:97647075-97647097 CCCACTGATGAAGAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934843634 2:97647089-97647111 GCAGGCGACTGGGTTGGAGAGGG 0: 1
1: 2
2: 2
3: 21
4: 254
934843626_934843634 6 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843634 2:97647089-97647111 GCAGGCGACTGGGTTGGAGAGGG 0: 1
1: 2
2: 2
3: 21
4: 254
934843629_934843634 -10 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843634 2:97647089-97647111 GCAGGCGACTGGGTTGGAGAGGG 0: 1
1: 2
2: 2
3: 21
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843634 Original CRISPR GCAGGCGACTGGGTTGGAGA GGG Exonic