ID: 934843635

View in Genome Browser
Species Human (GRCh38)
Location 2:97647101-97647123
Sequence GTTGGAGAGGGAGATCATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843628_934843635 3 Left 934843628 2:97647075-97647097 CCCACTGATGAAGAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934843635 2:97647101-97647123 GTTGGAGAGGGAGATCATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 320
934843626_934843635 18 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843635 2:97647101-97647123 GTTGGAGAGGGAGATCATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 320
934843629_934843635 2 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843635 2:97647101-97647123 GTTGGAGAGGGAGATCATGCTGG 0: 1
1: 0
2: 2
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843635 Original CRISPR GTTGGAGAGGGAGATCATGC TGG Exonic