ID: 934843636 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:97647113-97647135 |
Sequence | GATCATGCTGGCTGCAAAGA AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 929 | |||
Summary | {0: 1, 1: 1, 2: 17, 3: 115, 4: 795} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
934843628_934843636 | 15 | Left | 934843628 | 2:97647075-97647097 | CCCACTGATGAAGAGCAGGCGAC | 0: 1 1: 0 2: 0 3: 4 4: 61 |
||
Right | 934843636 | 2:97647113-97647135 | GATCATGCTGGCTGCAAAGAAGG | 0: 1 1: 1 2: 17 3: 115 4: 795 |
||||
934843626_934843636 | 30 | Left | 934843626 | 2:97647060-97647082 | CCTTTAGGTGGTGTTCCCACTGA | 0: 1 1: 0 2: 0 3: 9 4: 69 |
||
Right | 934843636 | 2:97647113-97647135 | GATCATGCTGGCTGCAAAGAAGG | 0: 1 1: 1 2: 17 3: 115 4: 795 |
||||
934843629_934843636 | 14 | Left | 934843629 | 2:97647076-97647098 | CCACTGATGAAGAGCAGGCGACT | 0: 1 1: 0 2: 0 3: 3 4: 95 |
||
Right | 934843636 | 2:97647113-97647135 | GATCATGCTGGCTGCAAAGAAGG | 0: 1 1: 1 2: 17 3: 115 4: 795 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
934843636 | Original CRISPR | GATCATGCTGGCTGCAAAGA AGG | Exonic | ||