ID: 934843636

View in Genome Browser
Species Human (GRCh38)
Location 2:97647113-97647135
Sequence GATCATGCTGGCTGCAAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 929
Summary {0: 1, 1: 1, 2: 17, 3: 115, 4: 795}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843628_934843636 15 Left 934843628 2:97647075-97647097 CCCACTGATGAAGAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934843636 2:97647113-97647135 GATCATGCTGGCTGCAAAGAAGG 0: 1
1: 1
2: 17
3: 115
4: 795
934843626_934843636 30 Left 934843626 2:97647060-97647082 CCTTTAGGTGGTGTTCCCACTGA 0: 1
1: 0
2: 0
3: 9
4: 69
Right 934843636 2:97647113-97647135 GATCATGCTGGCTGCAAAGAAGG 0: 1
1: 1
2: 17
3: 115
4: 795
934843629_934843636 14 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843636 2:97647113-97647135 GATCATGCTGGCTGCAAAGAAGG 0: 1
1: 1
2: 17
3: 115
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843636 Original CRISPR GATCATGCTGGCTGCAAAGA AGG Exonic