ID: 934843638

View in Genome Browser
Species Human (GRCh38)
Location 2:97647119-97647141
Sequence GCTGGCTGCAAAGAAGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934843628_934843638 21 Left 934843628 2:97647075-97647097 CCCACTGATGAAGAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934843638 2:97647119-97647141 GCTGGCTGCAAAGAAGGGACTGG 0: 1
1: 0
2: 0
3: 32
4: 297
934843629_934843638 20 Left 934843629 2:97647076-97647098 CCACTGATGAAGAGCAGGCGACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 934843638 2:97647119-97647141 GCTGGCTGCAAAGAAGGGACTGG 0: 1
1: 0
2: 0
3: 32
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934843638 Original CRISPR GCTGGCTGCAAAGAAGGGAC TGG Exonic