ID: 934845802

View in Genome Browser
Species Human (GRCh38)
Location 2:97660724-97660746
Sequence ATAGTCGCCCAGAGGGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934845796_934845802 -1 Left 934845796 2:97660702-97660724 CCAGAAAAACCGAAATCCAACCA 0: 1
1: 0
2: 2
3: 14
4: 170
Right 934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 27
934845797_934845802 -10 Left 934845797 2:97660711-97660733 CCGAAATCCAACCATAGTCGCCC 0: 1
1: 0
2: 1
3: 4
4: 71
Right 934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934845802 Original CRISPR ATAGTCGCCCAGAGGGTACC TGG Intronic
915217425 1:154349436-154349458 ATAGTCTCCCTGTGGGTCCCAGG - Exonic
1068798671 10:61114348-61114370 ATAGTGACCCAGAGGGTGCCTGG + Intergenic
1078141166 11:8694010-8694032 ACAGCAGCCCAGAGGGTCCCAGG + Exonic
1102606965 12:114075287-114075309 AAAGTCCCACAGAGGGTAACTGG + Intergenic
1105579201 13:21677564-21677586 ATTGTGGACAAGAGGGTACCAGG + Intronic
1115516193 14:34187629-34187651 ATAGTCCCCCTGGGGGTAGCAGG + Intronic
1115754092 14:36516715-36516737 CTAGGCGGCCAGAGGGTGCCGGG + Exonic
1121624314 14:95373348-95373370 ATAGACTCTCAGAGGGTCCCTGG - Intergenic
1146186505 17:30727817-30727839 ATAGCAGCGCAGAGGGAACCAGG + Intergenic
1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG + Intergenic
1157384752 18:47251373-47251395 AAAGACACCCAGAGGTTACCAGG - Intergenic
1162972337 19:14188240-14188262 ATAGCAGCGCAGAGGGAACCAGG - Intronic
934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG + Intronic
947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG + Intronic
948450502 2:238067588-238067610 CATGTCGCCCACAGGGTACCTGG - Intronic
1169216685 20:3798220-3798242 ATCGTCCCCCAGACGGTACAGGG - Intronic
1173443799 20:43099876-43099898 CTATTAGCCCAGTGGGTACCTGG + Intronic
1174500053 20:50977708-50977730 AGAGAAGCCCAGAGGGGACCTGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178083745 21:29092567-29092589 ATACTCACCCAGAGGGGAGCTGG - Exonic
1179805887 21:43836707-43836729 CTAGTCGGCCAGTGGGTACGAGG - Intergenic
1183721507 22:39565394-39565416 ATAGTCAGCCAGCTGGTACCGGG - Intergenic
953143469 3:40250805-40250827 ATTGTCTCCCAGAGGTCACCAGG - Intronic
966152297 3:176877809-176877831 GTAGTGGCCCAGAGGTTCCCTGG + Intergenic
993018626 5:82564301-82564323 GTAGTGGCCCAGAGTGTCCCTGG + Intergenic
998188276 5:139999845-139999867 ATACCCACCCAGAGGGAACCTGG + Intronic
1036237874 8:7057082-7057104 AGAGTCATCCAGAGAGTACCAGG - Intergenic
1048215632 8:132491962-132491984 ATAGTGGCCAATACGGTACCTGG + Intergenic
1061940077 9:133879079-133879101 ATAGTCTTCCAGAGGGGACCGGG + Intronic
1062634966 9:137485887-137485909 AGAGTCCCCCAGAGGGTCCCAGG + Intronic
1201304735 Y:12541150-12541172 AGAGGCGCCCAGAGGGGTCCAGG - Intergenic