ID: 934846346

View in Genome Browser
Species Human (GRCh38)
Location 2:97663631-97663653
Sequence GCTCTGCGACGCGGGCGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934846334_934846346 8 Left 934846334 2:97663600-97663622 CCGCCCGACTCGGGGAGGGGTCG 0: 1
1: 0
2: 0
3: 13
4: 60
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
934846325_934846346 19 Left 934846325 2:97663589-97663611 CCTGAACTTCCCCGCCCGACTCG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
934846333_934846346 9 Left 934846333 2:97663599-97663621 CCCGCCCGACTCGGGGAGGGGTC 0: 1
1: 0
2: 1
3: 15
4: 85
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
934846337_934846346 5 Left 934846337 2:97663603-97663625 CCCGACTCGGGGAGGGGTCGGGG 0: 1
1: 0
2: 1
3: 21
4: 272
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
934846332_934846346 10 Left 934846332 2:97663598-97663620 CCCCGCCCGACTCGGGGAGGGGT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80
934846339_934846346 4 Left 934846339 2:97663604-97663626 CCGACTCGGGGAGGGGTCGGGGA 0: 1
1: 0
2: 3
3: 12
4: 146
Right 934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934846346 Original CRISPR GCTCTGCGACGCGGGCGAGG GGG Intronic
900287780 1:1909765-1909787 CCTCTGCGAAGTGGGGGAGGAGG - Intergenic
900385255 1:2407679-2407701 GCTCTGCGACGAGGTCACGGTGG + Intronic
901007644 1:6179683-6179705 GGGCGGCGACGCGGGCCAGGCGG - Intronic
902067484 1:13700272-13700294 GCTCTGAGGCGCTGGCGCGGCGG + Intronic
922518268 1:226223920-226223942 GCGCTGCGACGCCGACGGGGCGG - Exonic
924624748 1:245688820-245688842 GCGCAGGGACGCGGGTGAGGAGG + Intronic
1062806382 10:422879-422901 GCTCTGCGTAGAGGACGAGGAGG + Exonic
1065186530 10:23174613-23174635 GCTCCGCGAGGCCGGCGGGGCGG - Intergenic
1065939810 10:30554091-30554113 GCTCTGCTACGCGGCTGAGCGGG - Intergenic
1074618624 10:115093987-115094009 CCTCTGCGACCCGGGCTGGGTGG + Exonic
1075841803 10:125511243-125511265 GCACCGCGACGGGGGCGGGGAGG - Intergenic
1076035548 10:127196267-127196289 GCTTAGCGACGCGCGCGGGGAGG + Intronic
1076895667 10:133310093-133310115 GCTCTGCTACGGGGGCATGGCGG + Intronic
1077055840 11:592651-592673 GCTCTGCGACGGCTGCGATGCGG + Exonic
1080540411 11:33258409-33258431 GCTCCGCGACGCTGGGGACGGGG - Intronic
1085561136 11:77473753-77473775 GCGAGGCGACGCGGGCGGGGGGG + Exonic
1088290113 11:108227020-108227042 GCTCTGCGGGGCGGGAGATGGGG - Intronic
1091225938 11:133956534-133956556 GGGCTCCGACGCGGGCCAGGCGG - Intronic
1091680287 12:2522111-2522133 GCTCTTCGACCTGGGCTAGGAGG - Intronic
1096009114 12:48198196-48198218 GCAATTCGGCGCGGGCGAGGCGG + Intergenic
1097166981 12:57091254-57091276 GCTGTGTGAGGCGGGTGAGGAGG + Exonic
1104942824 12:132402934-132402956 GCCCTGCCAGGCGGCCGAGGAGG + Intergenic
1105020934 12:132816488-132816510 GCTGAGCGACGCGGACGTGGAGG + Intronic
1113820527 13:113209495-113209517 GCTCGGGCACGCGGGCGGGGCGG + Intronic
1118801246 14:69191778-69191800 CGTGTGCGACGGGGGCGAGGGGG - Exonic
1119759630 14:77141436-77141458 GCCCTCTGCCGCGGGCGAGGCGG - Intronic
1122805483 14:104254198-104254220 GCTCGCCAACGCGGGCGAGAAGG - Intergenic
1123037271 14:105476600-105476622 GCTCTGGGACGTGGGCCAAGTGG - Intronic
1125609316 15:40960016-40960038 GCTCTGGGGCGCTGGGGAGGAGG + Intergenic
1128743014 15:70096397-70096419 GCTCTCCGACGGGGCGGAGGGGG + Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1139403001 16:66696836-66696858 GCTCCGCGGCTCGAGCGAGGTGG + Intergenic
1141831137 16:86510511-86510533 GCTCTGCGCCGCGGACGGGCCGG - Exonic
1143595071 17:7909232-7909254 CCTCGGCGAAGCGGGCGTGGAGG - Exonic
1144269106 17:13600799-13600821 GCCCCGCGACGACGGCGAGGAGG - Exonic
1144786895 17:17837004-17837026 GCTCTGCTGGGCGGTCGAGGCGG + Intergenic
1149470719 17:56913413-56913435 GCTCAGGGACGCGGGAGAGCAGG + Exonic
1152072107 17:78138997-78139019 GCTCTGCGAGGAAGGAGAGGAGG + Intronic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160979815 19:1811782-1811804 GCTGTGGGACGGGGGAGAGGTGG + Exonic
1161083304 19:2322095-2322117 GCTCTGAGACGCGGGGTAGCCGG - Intronic
1161379905 19:3959403-3959425 GCTCTGCCACGAGGACGTGGAGG - Exonic
1161505016 19:4639311-4639333 GCACTGCGACGGGGGGGAAGTGG - Intergenic
1161854039 19:6753618-6753640 ACCCTGCGACCCCGGCGAGGTGG - Exonic
1162261579 19:9538672-9538694 GCTCTCCGCCTCGGGCCAGGCGG + Intergenic
1162535989 19:11262876-11262898 GCGCTGAGACCCGGGCTAGGTGG + Intergenic
1163633729 19:18429223-18429245 GCCCTCCGAGGCGGGGGAGGGGG + Intronic
1164594771 19:29525868-29525890 GCTCTGGGGCGGGGGCGGGGCGG + Intergenic
930411097 2:51027607-51027629 CCCGTGCGAGGCGGGCGAGGAGG - Exonic
930762382 2:55050340-55050362 GCTCTGAGACGCGGCCCCGGCGG - Exonic
934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG + Intronic
939020788 2:136955943-136955965 GCTCTGCCTCCCGGGCGTGGTGG - Intronic
941951323 2:171160234-171160256 GGTCCGCGGCGCGGGAGAGGAGG + Intronic
948216723 2:236237849-236237871 GGTCTGCGCCGCGGCCGAGCAGG + Exonic
1171009894 20:21503518-21503540 GCTCTGTGACTCAGGGGAGGAGG - Intergenic
1174038555 20:47683167-47683189 AATCTGCAACACGGGCGAGGAGG + Exonic
1174648088 20:52103362-52103384 GGTCTGCGACACTGGCAAGGGGG - Intronic
1176005678 20:62861250-62861272 GCTAAGCGAGGCGGGCGCGGCGG - Exonic
1180014966 21:45075493-45075515 GCTCTGCGCCGCGGGCGGCCCGG + Intronic
1183931495 22:41238327-41238349 GCTCACCTACGCGGGCGAGGAGG - Exonic
954199926 3:49018139-49018161 GCCCAGCGAGGCAGGCGAGGCGG + Exonic
956129426 3:66039456-66039478 TCTCTGCGACCCGGGGGAGGGGG + Intergenic
962382720 3:134910433-134910455 GCTCTGTGAGGCTGGTGAGGAGG + Intronic
965576416 3:170222527-170222549 GGTCGGCGCTGCGGGCGAGGTGG + Exonic
966866333 3:184260865-184260887 GCCCTGGCACCCGGGCGAGGGGG - Intronic
968603747 4:1521922-1521944 GCTCTTCCTCGCGGGCCAGGGGG - Intergenic
968945718 4:3662620-3662642 GCACTGCGTCCCGGGTGAGGAGG + Intergenic
985895512 5:2748405-2748427 GGCCAGCGACGCGGGCAAGGCGG - Exonic
990955318 5:61333337-61333359 GCTGTGCGGGGCGGGGGAGGGGG + Intronic
992627498 5:78648689-78648711 GGTCCGCGGCGCGGGGGAGGAGG + Exonic
997304030 5:132825555-132825577 GCTCAGCCACCCGGGCGGGGAGG - Exonic
998938663 5:147257236-147257258 GCTCTACGTCGGGGGCGGGGCGG + Intronic
1002925075 6:1601383-1601405 GCTCTCACGCGCGGGCGAGGTGG + Intergenic
1022106186 7:27199592-27199614 GCTCTGCGCCGCTGCCGAGCAGG + Exonic
1026876182 7:73880312-73880334 TCTCTGGCATGCGGGCGAGGTGG + Intergenic
1028198512 7:87934428-87934450 GCTGAGCGTCTCGGGCGAGGCGG + Exonic
1045335929 8:101205013-101205035 GGTCTCCGAGGCGGGAGAGGCGG - Exonic
1059642983 9:116235431-116235453 ACTCTGGGACGTGGGCGAGGAGG + Exonic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062084448 9:134641637-134641659 ACTGGGCGCCGCGGGCGAGGGGG - Intergenic
1195894725 X:109733493-109733515 GCGCTGCGAGGAAGGCGAGGCGG + Intergenic
1198451049 X:136767393-136767415 GCGCCTGGACGCGGGCGAGGAGG + Intronic
1199787113 X:151115484-151115506 GCTGTGCGACCCGGGAGATGTGG + Intergenic
1200069424 X:153520387-153520409 GCTCTGTGAGGTGGGGGAGGAGG - Intronic