ID: 934846377

View in Genome Browser
Species Human (GRCh38)
Location 2:97663733-97663755
Sequence CGCGTCCTCCGCTCACTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934846377_934846389 25 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846389 2:97663781-97663803 GCGCCGCCGCGTGCGCCCCCGGG 0: 1
1: 0
2: 5
3: 27
4: 258
934846377_934846390 26 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846390 2:97663782-97663804 CGCCGCCGCGTGCGCCCCCGGGG 0: 1
1: 0
2: 1
3: 41
4: 292
934846377_934846393 30 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846393 2:97663786-97663808 GCCGCGTGCGCCCCCGGGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 164
934846377_934846381 -10 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846381 2:97663746-97663768 GGAGGACGCGCCGAGGCGGGCGG 0: 1
1: 1
2: 0
3: 20
4: 293
934846377_934846383 -8 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846383 2:97663748-97663770 AGGACGCGCCGAGGCGGGCGGGG 0: 1
1: 0
2: 0
3: 14
4: 224
934846377_934846388 24 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846388 2:97663780-97663802 TGCGCCGCCGCGTGCGCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 151
934846377_934846391 27 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846391 2:97663783-97663805 GCCGCCGCGTGCGCCCCCGGGGG 0: 1
1: 0
2: 4
3: 15
4: 170
934846377_934846384 -7 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846384 2:97663749-97663771 GGACGCGCCGAGGCGGGCGGGGG 0: 1
1: 1
2: 0
3: 44
4: 323
934846377_934846382 -9 Left 934846377 2:97663733-97663755 CCACGCAGTGAGCGGAGGACGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 934846382 2:97663747-97663769 GAGGACGCGCCGAGGCGGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934846377 Original CRISPR CGCGTCCTCCGCTCACTGCG TGG (reversed) Intronic