ID: 934846385

View in Genome Browser
Species Human (GRCh38)
Location 2:97663756-97663778
Sequence GGAGAGACCCCCGCCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934846385_934846401 27 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846401 2:97663806-97663828 CGGGGCGCCCGCCCTCCCCCTGG 0: 1
1: 0
2: 1
3: 56
4: 1974
934846385_934846390 3 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846390 2:97663782-97663804 CGCCGCCGCGTGCGCCCCCGGGG 0: 1
1: 0
2: 1
3: 41
4: 292
934846385_934846391 4 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846391 2:97663783-97663805 GCCGCCGCGTGCGCCCCCGGGGG 0: 1
1: 0
2: 4
3: 15
4: 170
934846385_934846389 2 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846389 2:97663781-97663803 GCGCCGCCGCGTGCGCCCCCGGG 0: 1
1: 0
2: 5
3: 27
4: 258
934846385_934846388 1 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846388 2:97663780-97663802 TGCGCCGCCGCGTGCGCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 151
934846385_934846393 7 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846393 2:97663786-97663808 GCCGCGTGCGCCCCCGGGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 164
934846385_934846395 8 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846395 2:97663787-97663809 CCGCGTGCGCCCCCGGGGGCGGG 0: 1
1: 0
2: 1
3: 22
4: 190
934846385_934846396 9 Left 934846385 2:97663756-97663778 CCGAGGCGGGCGGGGGTCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 934846396 2:97663788-97663810 CGCGTGCGCCCCCGGGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934846385 Original CRISPR GGAGAGACCCCCGCCCGCCT CGG (reversed) Intronic